Statistiken fr: www.ecmjournal.org

Auslastungsstatistik für den Zeitraum: August 2013 - Suche
Erstellt am 01-Sep-2013 00:17 CEST


     Anfragen      Suche
----------------  ----------------------

361        6.49%  @aol @comcast @hotmail @gmail @yahoo
46         0.83%  ecm journal
33         0.59%  inurl: @ua
25         0.45%  european cells and materials
23         0.41%  fluorapatite structure
23         0.41%  research on repair strategies for articular cartilage defects
19         0.34%  giftsamuel52@yahoo.com
19         0.34%  pakistan emails@yahoo.com@gmail.com@hotmail.com@ymail.com@mail.ru2011
18         0.32%  traders search engines in asia @yahoo.com @gmail.com @msn @juno
17         0.31%  metal manufacture industry in europe @sina.com@yahoo.com@hotmail.com@126.com@163.com@gmx.com
16         0.29%  @aol @comcast @hotmail @gmail @yahoo @qq
15         0.27%  suppliers manufacturing@hotmail.com
15         0.27%  www.redwap.comجدید
12         0.22%  @mail @yandex @hotmail @gmail @rambler
12         0.22%  http://www.ecmjournal.org/journal/papers/vol013/pdf/v013a01
11         0.20%  sمقاطع سكسي اجنبي
11         0.20%  wrought cobalt chromium molybdenum alloy
11         0.20%  www89cob
11         0.20%  موزيلاسكس بنات
10         0.18%  european cells
9          0.16%  dental pulp tissue engineering with stem cells from exfoliated deciduous teeth
9          0.16%  wire mesh buyer@prodigy.net.mx
8          0.14%  european cell and materials
7          0.13%  ecm journal impact factor
7          0.13%  eur cell mater
7          0.13%  http://www.ecmjournal.org/stats/search_201305.html
7          0.13%  افلام سكس طركي
6          0.11%  @aol @comcast @hotmail @gmail @yahoo@yandex@mail
6          0.11%  current companies in korea their emails @163.com @126.com @hotmail.com @yahoo.com @org @oal
6          0.11%  http://www.tubexclips.com/categories/arab1.html
6          0.11%  i need an urgent loan u.s @gmail @ymail @hotmail
6          0.11%  manufacturers buyers sellers electronics @yahoo.pk @hotmail @cyber.net.pk
6          0.11%  picture xxxgipls
6          0.11%  www.ghana grils .cmo
6          0.11%  www.google.com/searchsafe=off
5          0.09%  adobe.com
5          0.09%  brunei business emails @aol.com @yahoo com@hotmail @gmil .com txt
5          0.09%  china ltd hardware *@163.com@yahoo.com@gmail.com@126 ... @gmail.com 2013 manufacturers and dealers of ... computer and laptop s
5          0.09%  http://www.ecmjournal.org/stats/search_200910.html
5          0.09%  http://www.ecmjournal.org/stats/search_201302.html
5          0.09%  ibrahim.ali699@yahoo.com
5          0.09%  ich brauche einen kredit @gmail.mx@hotmail.mx@yahoomail.mx
5          0.09%  iron wire @infoclub.com.np
5          0.09%  textile
5          0.09%  www.123.49.35.79/cmh.
5          0.09%  xxxvideo pakistan@
5          0.09%  صور سکساوی
4          0.07%  13 mr albert email contact@gmx.de -scam -scammers
4          0.07%  965 judy joan carol hasan mark mary smith alex morgan anna cindy anita henry relmond james juliet yahoo.com gmail.com hotmail a
4          0.07%  971 khalifa @hotmail.com @yahoo.com @gmail.com-scam xls 2013
4          0.07%  @abpl-ng.com
4          0.07%  @aol @comcast @hotmail @gmail @yahoo @mail @yandex
4          0.07%  @aol @ig.com.br @hotmail @gmail @yahoo
4          0.07%  @nsfegypt.com
4          0.07%  ac contactors @yahoo.ur
4          0.07%  application of swnt pdf
4          0.07%  belaangelkada
4          0.07%  carbon nanotube in medicine
4          0.07%  eur cells mater
4          0.07%  germany business emails @aol.com @yahoo @hotmail @gmil .com txt
4          0.07%  groupsex 25@yahoo.com
4          0.07%  hong kong business emails @aol.com @yahoo com@hotmail @gmil .com txt
4          0.07%  http://abdu1.wen.ru/games/main.html
4          0.07%  http://www.ecmjournal.org/stats/search_201306.html
4          0.07%  indiansex videos .company
4          0.07%  iran sex تحمیل فیدیوسکس
4          0.07%  jaime oliver p @gmail.com @aol.com @msn.com @live.com @hotmail.com @yahoo.com.sg.txt
4          0.07%  judith usi. solomon islands. native. porn
4          0.07%  justonmeyer@facebook
4          0.07%  k.hamad2011@yahoo.com
4          0.07%  led tube@rawagegypt.
4          0.07%  list of job seekers @aol.com@sbcglobal.net@comcast.net :txt
4          0.07%  localhost:e:\others\page\سكس.uhtm
4          0.07%  online today members free email penpal dating site angola @hotmail gmail yahoo com mx
4          0.07%  tire buyer@
4          0.07%  www .com pakistan sxye vdoes doaloaed/
4          0.07%  www doh doh com@ dot com nepali sex
4          0.07%  www.busty cats.com/mobile/kore
4          0.07%  الصوسكس ‏xxx
4          0.07%  الكويت مسلم الفتيات date@hotmail.com، @ msn.com، live.com @، @ yahoo.com، @ yahoo.be، @ yahoo.fr، @ yaho
4          0.07%  تحميلwww.brazzer.com
4          0.07%  سكس فيدو2013
4          0.07%  صور مليساسكس
4          0.07%  مواقع افلام اباحيةwww.lycos.com
4          0.07%  نيك سكس بنغلديش
3          0.05%  .سكس سود
3          0.05%  2013 mailling adds off student in afganistain that is seeking for a loan@yahoo.com @hotmail.com -
3          0.05%  244 @yahoo.au
3          0.05%  28 manufacturing company yahoo com'' 'importer exporter manufacturer producer' --scam-fraud
3          0.05%  52 gomez @yahoo.com.mx from 2013
3          0.05%  @aol @comcast @hotmail @gmail @yahoo @
3          0.05%  @hotmail @gmail @uol.txt
3          0.05%  @hotmail @gmail @yahoo
3          0.05%  @pec.com.vn
3          0.05%  @sankyo.com.br
3          0.05%  @sex. gamil.com
3          0.05%  @yahoo.qa yahoo.ae yahoo.sa yahoo.za yahoo.ca yahoo.jo yahoo.co.uk @hotmail.com @yahoo.ae @hotmail.com..@gmail.com
3          0.05%  @yeah @yahoo.com.hk manufacturers buyer seller 2013
3          0.05%  adlar @yahoo.de @gmx @hotmail.de @camcast.de @edu.de @gmail.de
3          0.05%  agent and distributors a to z@yahoo.com@gmail.com@hotmail.com
3          0.05%  alfonso monavez@gmail.com
3          0.05%  amirgeece@hotmail.com
3          0.05%  amirgreece @yahoo kom
3          0.05%  amirgreece42@yahoo.com
3          0.05%  australia crude oil importers and exporters email listing @gmail.com@yahoo.com@126.com@163.comlive.com@hotmail.com
3          0.05%  automobile and cars shipping company and firm in china @yahoo@gmail.com
3          0.05%  cctv camera @rawagegypt.com
3          0.05%  cctv camera supplier @webmail.co.z
3          0.05%  cctv cameras @yemen.net.ye
3          0.05%  chen @shaw.ca txt
3          0.05%  chen @yahoo.com.cn txt
3          0.05%  china auto spare parts manufacturers @126.com @163.com @yahoo.de @gmail.com @hotmail.com @yahoo.com
3          0.05%  contato email daniela @gmail.com @yahoo.com @bol.com.br @ig.com.br @hotmail.com @yahoo.com.br @uol.com.br @r7.com @brturbo.com.
3          0.05%  current strategies for articular cartilage repair
3          0.05%  director ngo in nigeria 2013 email@yahoo.com''gmail.com''hotmail.com''mail.net
3          0.05%  director@yahoo.com estonia
3          0.05%  doctors@yahoo.com belgium
3          0.05%  e-mail pesquisa yahoo com hotmail com gmail com em angola
3          0.05%  e@gmx.de.dewanadoo.fr yahoo gmail hotmail@ emailchristophlab equipments distrubutors in asia @yahoo @gmail @hotmail @rocketm-
3          0.05%  ecm ao
3          0.05%  ecm conference
3          0.05%  email @hotmail.de @msn.de
3          0.05%  email @live.det @hotmail.de @msn.de @aol.de @yahoo.de
3          0.05%  email directory of australian companies @y ahoo.com@gmail.com @hotmail.com
3          0.05%  emmanuela daniel 2011 @yahoo.com @in.tt @att.net @gmail.com @hotmail.com @aol.com @earthlink.net @msn.sg.txt
3          0.05%  european cells and materials journal
3          0.05%  free classified indian ads email contact @yahoo.com @gmail.com @hotmail.com @yahoo.in @radiffmail.com
3          0.05%  french videos on tubexclips.com - free porn videos xxx porn ... jpldg htgl
3          0.05%  fresh email leads wallance@yahoo.com @southbell.com @yahoo.com.hk @yahoo.com.au
3          0.05%  from 91@ rocketmail com tits
3          0.05%  ftp://132.248.118.14
3          0.05%  ftp://shop:1828@ftp2.belle.com.hk/
3          0.05%  glass producers distributors @yahoo @gmail
3          0.05%  hong kong gold buyer association @hotmail.com.hk
3          0.05%  http://ecmjournal.org/journal/papers/vol025/vol025a15.php
3          0.05%  http://www.dubaiairport.com/ar/pages/home.aspx
3          0.05%  http://www.ecmjournal.org/stats/ref_200910.html
3          0.05%  http://www.ecmjournal.org/stats/search_201001.html
3          0.05%  http://www.ecmjournal.org/stats/search_201202.html
3          0.05%  http://www.ecmjournal.org/stats/search_201204.html
3          0.05%  http://www.ecmjournal.org/stats/search_201211.html
3          0.05%  http://www.google.com/webhphl=en
3          0.05%  http://www.metabot.ru/forumopen=1259329744_3933
3          0.05%  ich brauche eine dringende darlehen 2013
3          0.05%  ich brauche eine dringende darlehen of10000euro 2013 @gxm @yahoo.de @hotmail.de @live.de @aol.de
3          0.05%  info h-k dk
3          0.05%  jay @yahoo.comyahoo.cayahoo.uk 2012 leads
3          0.05%  jennifer 2011 @gmail.com @sbcglobal.net @hotmail.com @aol.com @earthlink.net @msn. @live.comsg.txt
3          0.05%  johnlewismicheal jerry frank alicolemusamohamed@yahoo.comhotmail.comafricanonline.aol.comyamil.comgmail.comrediiffmail.com
3          0.05%  kshx pdhk seex vedio
3          0.05%  lسكس جالب
3          0.05%  m.drugvokrug.ru/index.htm nokia300
3          0.05%  mail yahoo hotmail gmail ext txt
3          0.05%  martin@yahoo.com txt sub 2013 _419
3          0.05%  mosearthur@yahoo.com.site
3          0.05%  nano structure silica neuron cell
3          0.05%  new fohttpwww.hot-sex-tube.comcategoriesass1.htmllder
3          0.05%  nxnx xx @hotmail
3          0.05%  online usa traders and suppliers tel: fax: 2013 @hotmail com @juno com @yahoo com @yahoo co uk @gmail com @comcast net @aol com
3          0.05%  pamuk şeker @hotmail . com 123456789
3          0.05%  paraffin wax @netzero.net @twcny.rr.com @comcast.net
3          0.05%  penpals@yahoo.com
3          0.05%  persian rug distributors in asia @yahoo.com@hotmail.com@gmail.com@aol.com guestbook2013
3          0.05%  properties of cobalt chromium molybdenum pdf
3          0.05%  realty agent member associate in india-
3          0.05%  rusiloaeni@ymail.com
3          0.05%  scanning microscopy
3          0.05%  songs ndj music 765 @gmil pk
3          0.05%  south korea wholesale suppliers business @sales.com@yahoo.com
3          0.05%  titanium dioxide wanted@yahoo.com
3          0.05%  uganda business emails@ yahoo.com @ gmail.com @ hotmail.com @ txt
3          0.05%  uhtm1.sex
3          0.05%  usa tile buyer @gmail
3          0.05%  vegf-f weight molecol pdf
3          0.05%  www @googl sax com
3          0.05%  www.google.co.in/searchie=iso-8859-1
3          0.05%  www.google.com.sg/searchclient=chrome-mobile
3          0.05%  www.yahoo.com
3          0.05%  wwwwسكس
3          0.05%  xxx saxi vdavo com
3          0.05%  xxمجاني للتحميل على الجوال
3          0.05%  تحميل مقطع فبديوسكس
3          0.05%  دانلودsex video چین redwap
3          0.05%  صورشميل
3          0.05%  مصر 21@hotmail.eg @yahoo.eg @gmail.com 2013
2          0.04%  %sافلام
2          0.04%  %sافلام سكس
2          0.04%  . @yandex.ru @email.cz @ukr.net -
2          0.04%  .jonathan.maged.7 @yahoocom
2          0.04%  .wwwxvideos
2          0.04%  .wwwxvideos cim
2          0.04%  .سكس حىوانات وبنات
2          0.04%  .سكس نيك قوي.goo
2          0.04%  1 2011@gmail.com @aol.com
2          0.04%  1 email qmail.com netzero.com netscape.com yahoo.jp.com evelyn doha
2          0.04%  123yaho.com .arabic
2          0.04%  18qt.com/best/koreanl.shml
2          0.04%  1association deaf@aol.com@yahoo.com@comcast.net@blackberry.net@gmai.com
2          0.04%  1jack.comhotmail.com@yahoo.com@gmail.com@oal.com
2          0.04%  2013 971 mohammed @hotmail.com txt
2          0.04%  2013 inc aircraft engineers @hotmail.com
2          0.04%  234 oil and gas @yahoo @ymail @gmail @hotmail
2          0.04%  234 yahoo com gmail com ymail com yahoo co uk scam spam filetype rtf
2          0.04%  358 @sbcglobal.net greece oil dealers
2          0.04%  36 andrea@lilo2000.hu @yahoo.hu @hotmail.com
2          0.04%  3pgking kore@
2          0.04%  43 @yahoo.co.au @hotmail.com @aol.com -5/12/2011
2          0.04%  45 oil dealers @yahoo.com txt
2          0.04%  49 alexander @yahoo.com @aol.com @comcast.net -2/22/2013
2          0.04%  60 yuan @yahoo.com.qa @yahoo.com.my @gmail.com @hotmail.com @yahoo.com 2013
2          0.04%  65 cheng @yahoo.com.sg @bellsouth.net @cs.com @charter.net @earthlink.net 2014 txt
2          0.04%  69 uae ahmadi@yahoo.com
2          0.04%  786 nasir gmail@ come
2          0.04%  84 leather cotton @gmail.com @hotmail.com @yahoo.com @comcast.com @txt
2          0.04%  86 auto spare parts exporters @yahoo.com@gmail.com @126.com@123.com
2          0.04%  86***********supplier***************china***************hong kong*************email***************2013.txt
2          0.04%  965 ahmad @yahoo.com @gmail.com @hotmail
2          0.04%  965.abu@gmail@hotmail@yahoo@aol@my net.com
2          0.04%  966 trading @yahoo.com@hotmail.com@gmail.com
2          0.04%  97 gas @hotmail.com 2013 csv/txt
2          0.04%  97157 factory azebajan @hotmail.com @gmail.com @yahoo.com
2          0.04%  973 kuwait @ national exchange companies member 2013
2          0.04%  98iran@gmeil.com
2          0.04%  : asd closure using autologous pericardium (glutaraldehyde treated)
2          0.04%  @#$%
2          0.04%  @163.com @hotmail.com
2          0.04%  @@@@ maria @hotmail.com txt
2          0.04%  @aol @comcast @hotmail @gmail @yahoo @mail
2          0.04%  @aol @comcast @hotmail @gmail @yahoo @mail @yandex @rambler
2          0.04%  @aol @comcast @hotmail @gmail @yahoo @mail.ru
2          0.04%  @aol @comcast @hotmail @gmail @yahoo @uol
2          0.04%  @aol @comcast @hotmail @gmail @yahoo @uol @ig @terra
2          0.04%  @aol @comcast @hotmail @gmail @yahoo fb.com @mail.ru
2          0.04%  @aol.com txt 2013
2          0.04%  @ar msn.com % csv txt 2012
2          0.04%  @enppi-sa.com
2          0.04%  @gmail @terra @hotmail @ig @yahoo @bol @uol
2          0.04%  @hotmail @yahoo @outlook.com @outlook.com.br @live.com
2          0.04%  @hotmail.com @gmail.com @yahoo.cn
2          0.04%  @hotmail.com nusre database alumni list
2          0.04%  @mail @gmail office@ info@
2          0.04%  @yahoo @hotmail=new signup usersusa@companies
2          0.04%  @yahoo.com @hotmail.com @gmail.com tiles seller
2          0.04%  @yahooo hg
2          0.04%  adultserbia@yahoo.com
2          0.04%  albart @hotmail.com @gmail.com
2          0.04%  alejandra@yahoo.com@hotmail.com 2013 txt
2          0.04%  alibaba leads tag emails leads in south africa @aol @comcast @hotmail @gmail @yahoo @hotmail @hinet.net @edu @aol.com
2          0.04%  aluminium companies in asia@yahoo.com@hotmail.com@gmail.com@4share.com
2          0.04%  american fishing dealers@aol.com@gmail.com
2          0.04%  analstreched
2          0.04%  animal models for implant biomaterial research in bone: a review
2          0.04%  animal study for bone regeneration orthopedic implant
2          0.04%  articular cartilage repair
2          0.04%  asia cotton company @yahoo
2          0.04%  asia sellers goods buyers export import @yahoo.com @ymail.com @rocketmail.com
2          0.04%  assessment of tb case detection practices review literatures pdf
2          0.04%  bbwمصرى
2          0.04%  bdmobi.sixygirl.com
2          0.04%  beijing **** co. (pvt) ltd @ms
2          0.04%  bernardgarcia886@yahoo.com
2          0.04%  berry % @yahoo.co.uk' @bellsouth.net' @msn.com' %2012\2013 txt
2          0.04%  big parkistian boob porn pictures
2          0.04%  blessing 40_william@yahoo.com.siapa dia
2          0.04%  boobs and pussy sharmila
2          0.04%  brian @aol.com @yahoo.com @hotmail.com @gmail.com.txt.2013
2          0.04%  business men looking for for loan @yahoo org @gmail com @hotmail org @comcast net 2013
2          0.04%  buyers and sellers of wood@yahoo.com@123.com@hotmail.com@163.com@263.com
2          0.04%  cartilage engineering: a crucial combination of cells collagen and hyaluronic acid
2          0.04%  cathyjames1@yahoo.in
2          0.04%  chang@yahoo.com@gmail.com@hotmail.com@live.com@aol.com@me.com txt
2          0.04%  chinase contacts for companies e-mails @qq.cn 2013 list yahoo.cn
2          0.04%  christielui
2          0.04%  co culture
2          0.04%  co-culture
2          0.04%  co-culture experiments
2          0.04%  companies in thailand that manufactured iron list@yahoo.comyahoo.cn@hotmail.com
2          0.04%  company supplier in china @163. @126. @yeah.
2          0.04%  comparative study assessing effects of sonic hedgehog and vegf in a human co-culture model for bone vascularization strategies
2          0.04%  contact deboracontact.pl
2          0.04%  contact email online relationship zambia single @ hotmail gmail yahoo.com.mx
2          0.04%  current manufacturing company emailhotmailgmail in china.com
2          0.04%  daniel vegas @yahoo @aol @hotmail 2013
2          0.04%  database emails of oil company %40yahoo.de %40gmail.de %40hotmail.de %40aol.de
2          0.04%  dennis@yahoo.com @hotmail.com @gmail.com @aol.com @comcast.net xls @mail.com 2013
2          0.04%  dhakawap.com/file/file.htmlfile=load/dhakawap/ir
2          0.04%  director@yahoo.com slovakia
2          0.04%  directories south korea and hong kong goods exportation @yahoo.com @yahoo.co.kr
2          0.04%  directory of importers and exporters in malaga @yahoo @gmail
2          0.04%  dns1 edi.com 28 41 porno mein bild
2          0.04%  dns1 edi.com porno abmahnung
2          0.04%  ecm
2          0.04%  ecmjournal.org
2          0.04%  email @live.ch hotmail.ch @msn.ch @aol.ch
2          0.04%  email @live.de hotmail.de @msn.de @aol.de
2          0.04%  email addresses of dog food in asia @yahoo@hotmail@gmail@sn@sina
2          0.04%  email and names divine@yahoo.com paul@gmail mohammed @hotmal
2          0.04%  email of women i need of loan @gmail.us @yahoomail.us @hotmail.us
2          0.04%  engineer@yahoo.com hungary
2          0.04%  engineercarsbusiness marina zeller @yahoo.pl @yahoo.ch
2          0.04%  eur cell mater impact factor
2          0.04%  euro cell mater
2          0.04%  euro cell matrix
2          0.04%  european cell
2          0.04%  european cell material journal
2          0.04%  european cells and materials griboi
2          0.04%  european cells and materials impact factor
2          0.04%  european cells and materials vol 11 2006
2          0.04%  f i l e t y p e :*****@gma i l . c om i n t e x t : f a c e b o o k i n t e x t : p a s s wo r d
2          0.04%  fabric and cotten factories in china@hotmail.cn@live.cn@gmail.com@yahoo.cn
2          0.04%  face @com .yahoo
2          0.04%  faemil.sex.www.com
2          0.04%  fax 00 @yahoo.ca @yahoo.com.br @ mail.ee @gmail.com @oal.com
2          0.04%  foma sh902is software center in pakistan
2          0.04%  formic acid importer
2          0.04%  france suppliers and manufacturers email @yahoo @gmail @hotmail @126 filetype xls
2          0.04%  freshmail@info@yahoomails @gmail.com @hotmail@txt
2          0.04%  g. @gmail.com@cox.net@uol.net@realtors.com@hotmail.com@yahoo.com
2          0.04%  galvanized steel pipe .com .net .org .edu inurl
2          0.04%  gana williams gmail.com@yahoo.co.uk@att.com@msn.com@aol.com@yahoo.com txt 2013 july
2          0.04%  girls delivery in america .india. hospital nude download video 3gp in hospitl
2          0.04%  google sex iran .arbic
2          0.04%  googleسكس أوربى
2          0.04%  guest book .in usa @yahoo.com @hotmail.com @aol.com
2          0.04%  gusetbook 2013 @aol.ch @hotmail.ch -vlz
2          0.04%  hassan.aandpartners@yahoo.com
2          0.04%  hd camera%40yandex.ru
2          0.04%  heavy duty machines manufacturers @163.com @126.com @webmail.com txt
2          0.04%  hillbert@bellsouth@earthlink@hotmail@gmail@dodo@yaoo.com
2          0.04%  hotsex xxx com vederos
2          0.04%  http://2013.triolan.org/service/default.aspx
2          0.04%  http://abdu1.wen.ru/cy/book/monao-1.html
2          0.04%  http://www.18qt.com/niches/arab1.shtml
2          0.04%  http://www.ecmjournal.org/journal/papers/vol004/pdf/v004a04
2          0.04%  http://www.ecmjournal.org/journal/papers/vol009/pdf/v009a04
2          0.04%  http://www.ecmjournal.org/stats/search_201011.html
2          0.04%  http://www.ecmjournal.org/stats/search_201203.html
2          0.04%  http://www.goldporntube.com/pages/american1.shtml
2          0.04%  http://www.goldporntube.com/pages/anal6.shtml
2          0.04%  http://www.googl.tupe8.com
2          0.04%  http://www.google.com/searchcute-christ king.org
2          0.04%  http://www.tubepornfever.com/movies/japanese1.shtml
2          0.04%  hydraulic hose @multi-industrie.de
2          0.04%  hypoxia and differentiation
2          0.04%  i need a loan 2013 jude@gmail.com smith@hotmail.com robert@yahoo.com
2          0.04%  i need a loan of 10000 dolars in canada aol @comcast @hotmail @gmail @yahoo @globo.com @r7.com @gmail.com text 2013/2014
2          0.04%  i need an urgent loan in spain / 3000euros post free classifieds ads / @hotmail.com @gma
2          0.04%  ich brauche dringend einen kredit in deutschland @web.de @yahoo.de @gmx.de 2013
2          0.04%  importers and exporters of tomateos in a large quantity@yahoo.com.cn or @gmail.com or @hotmail
2          0.04%  importers and exporters of truck head and busses in china indonesia and dubai gmail yahoo aol 126 xls
2          0.04%  in vivo biocompatibility testing of bone implant
2          0.04%  indiagiralxxx youtube
2          0.04%  indians in kuwait hotsex
2          0.04%  info gallagher cl
2          0.04%  info maxnetsys com cn
2          0.04%  info rekta com tr
2          0.04%  inosculation of tissue-engineered capillaries with the host's vasculature in a reconstructed skin transplanted on mice
2          0.04%  inport and export of wine @yahoo.com @163.com @hotmail com filetype txt 2013 update
2          0.04%  investment property listingscoloradousa @yahoo.com or @hotmail.com or @aol.com or @comcast.net or @bellsouth.net or @gmail.com 
2          0.04%  ip30.89.152.5 its location
2          0.04%  iran assporn
2          0.04%  iron wire @adsl.loxinfo.com
2          0.04%  iron wire @qatar.net.qa
2          0.04%  jan@aol.com mustafa@yahoo.com @gmail.com @hotmail.com @bellsouth.com net.com @sa.comtxt csv
2          0.04%  jawa.gogal.com/google-mail.htmlafdt=
2          0.04%  jean @hotmail @yahoo
2          0.04%  jtpen@cox.net
2          0.04%  kasongo @yahoo.fr @gmail.com @hotma.fr 243
2          0.04%  kerala full movie @sex tube wap.com
2          0.04%  klinefelter syndrome.klinefelter syndrome.laptop with camera price in .pk
2          0.04%  kuwait@hotmail.com
2          0.04%  kuwaiti @yahoo.com@hotmail.com@rocketmail.com
2          0.04%  kuwita sexgiral picture
2          0.04%  list of buyers and sellers yahoo email address of gold yahoo.com.cn.sg.hk.ph.uk
2          0.04%  list of importers in thailand @yahoomail.com
2          0.04%  live/xxxsexc /garl com @uk
2          0.04%  m.youtube.com/resultsgl=in
2          0.04%  m.youtube.com/resultshl=ar
2          0.04%  manufacturer and producers of ***steel*** in china email @yahoo.com@163.com@126.com .txt
2          0.04%  manufacturers china@yahoo.com@gmailcom@hotmail.com
2          0.04%  mason@hotmail.com@yahoo.com@gmail.com@aol.com.sfr.com203
2          0.04%  medical application of carbon
2          0.04%  mr. jan @hotmail.se @yahoo.se 2102 46
2          0.04%  my aim is bussineesmen but bussiness is not good you suggest me
2          0.04%  mypronwap brunei
2          0.04%  naphthalene pdf
2          0.04%  natalischatz@yahoo.de
2          0.04%  nelson @yahoo.com @aol.net@gmail.com xls 2013
2          0.04%  new fo httpwww.hot-sex-tube.comcategoriesass1.html dir
2          0.04%  no. 45 kabul afghanistan @hotmail.com
2          0.04%  non credit parkistain dating site
2          0.04%  ortho implants and usage
2          0.04%  p0rnwap
2          0.04%  pakestany sixy girls xxnxx
2          0.04%  paskistane sex vedios 3gp/
2          0.04%  pastor arthur dean@sbcglobal.net txt
2          0.04%  patellar cartilage damage cells repaired
2          0.04%  pellet culture model for human primary osteoblasts
2          0.04%  people buying and selling motor parts@yahoo.com.cn or gmail.com or hotmail.com
2          0.04%  phd@yahoo.com belgium
2          0.04%  philipp.heinzer @hotmail.com @bluewin.ch schweiz broker darlehen
2          0.04%  phlipiens youngo fuck clip
2          0.04%  plastic company owners@yahoo.com@hotmail.com@gmail.com aol.com @att.net
2          0.04%  polymer nanocontainers for biomedical applications
2          0.04%  polyurethane electrospinning tunin porosity
2          0.04%  pornoxo free mobile porn videos - free porn categories.uhtm
2          0.04%  poultry f video-one.com http
2          0.04%  pvc buyer@hotmail.com
2          0.04%  q=asif client=ms 7-opera_mb_no
2          0.04%  realtors 92392-7647 @hotmail.com @sbcglobal.net @bellsouth.net @att.net @yahoo.com @msn.com ''2013
2          0.04%  reeved@homail.com@gmail.com@gxm.com xls 2013
2          0.04%  remodel bone wang chao
2          0.04%  saadia-saudia 2010@ yahoo.com
2          0.04%  salitak biw=320
2          0.04%  sandhu356@hotmail.com
2          0.04%  sandra v 1999@ hotmail.com
2          0.04%  santos turkey @hotmail @gmail @yahoo @msn @aol ---------------------2013
2          0.04%  sarah@yahoo.com.se £££ georgia@yahoo.com.se %%% sophie@yahoo.com.au
2          0.04%  scanning microscopy journal
2          0.04%  seafood companies and manufactures llc and importers and exporters@yahoomail@hotmail@gmail@126
2          0.04%  shemales fuckiggirles
2          0.04%  six veduo austrlia
2          0.04%  skin equivalent vascularization
2          0.04%  stainless steel jewelry importer@aol.com
2          0.04%  steel coils @qatar.net.qa
2          0.04%  steel companies in asia@yahoo.com@gmail.com@hotmail.com@4share.net
2          0.04%  stem cell treatment china 606@hotmail.com
2          0.04%  sudıaraba
2          0.04%  suppliers industrial rubber belts ltd @yahoo @hotmail in asia
2          0.04%  suppliers manufacturers importers exporters in italy@yahoo.com@gmail.com
2          0.04%  suppliers of copper chin lee@ yahoo llc.xls
2          0.04%  taiwan church emails directory 2013 yahoo hotmail gmail aol
2          0.04%  teampro31.wap.sh
2          0.04%  textiles and fabric ltd
2          0.04%  textiles co. ltd
2          0.04%  tin box buy @comcast.net
2          0.04%  toner cartridge @wannado.fr
2          0.04%  top chinese beverage manufacturing companies @yahoo@gmail.com
2          0.04%  turkey manufacturer email @yahoo.com filetype:pdf or filetype:doc orfiletype:xls
2          0.04%  u s a @yahoo.com@aol.com@hotmail.com@yahoo.co.uk@att.com@yahoo.co.net micheal 2012..2013
2          0.04%  uae autospare parts sellers @emirates.ae @eim.ae
2          0.04%  urmeila hot fakking pichars
2          0.04%  valve importers@omantel.net.om
2          0.04%  vidiosexprono italia
2          0.04%  vv com net ca phone fax email phone 1 @yahoo.com
2          0.04%  want an urgent loan in usa @msn @fr @gmail @yahoomail @hotmail
2          0.04%  wap sex .xstem.com
2          0.04%  why cell coculture
2          0.04%  wire mesh buyer@africaonline.co.zw
2          0.04%  wire mesh buyer@infoclub.com.np
2          0.04%  wire mesh buyer@infovia.com.ar
2          0.04%  wire mesh@aol.com
2          0.04%  wire mesh@zol.co.zw
2          0.04%  www .arbic girls and hot fuccking image.com
2          0.04%  www asean film seks @yahho com
2          0.04%  www banglashes 20013 new colles vibo move xxx com.
2          0.04%  www dot com@ punjabi videos saxys garls
2          0.04%  www.afghaistansex girls pussy pron pictres.com
2          0.04%  www.aribian sexy @com
2          0.04%  www.freshbf.in
2          0.04%  www.google.co.ipn/webhpie=iso-8859-1
2          0.04%  www.google.com/mclient=ms-nokia
2          0.04%  www.google.com/searchhl=en
2          0.04%  www.ibrahim.ali699@yahoo.com
2          0.04%  www.nepali sex@gmail.com
2          0.04%  www.redvap.com2014
2          0.04%  www.sex free(very big cocks big asses big booys womans ).com.net
2          0.04%  www.sexyvideos .usa
2          0.04%  www.ufone.com/login.apsx
2          0.04%  www.xnxx@hotm.com
2          0.04%  wwwhotsex@atyahoocom
2          0.04%  xls oil marketers in arab @yahoo com @hotmail com
2          0.04%  xls pipe companies @yahoo com @hotmail com @aol com xls
2          0.04%  xnxx .cmo
2          0.04%  xnxx com@
2          0.04%  xnxxarbic iraq
2          0.04%  xnxx   
2          0.04%  xnxxتحميل فيلم سكس
2          0.04%  xnxxتنزيل أفلام موبيل ساره جري
2          0.04%  xnxxتنزيل أفلام موبيل ساره جيري
2          0.04%  xxxسكسى
2          0.04%  zhou@yahoo.com@gmail.com@hotmail.com@aol.com@live.com txt
2          0.04%  أفلام سكس اسرايلي2013
2          0.04%  احلا قصص سكس موحرمات لبنات
2          0.04%  اريدمشاهدةسكس.اسراءيلى
2          0.04%  بورنوسكس جنس حيوانا ت
2          0.04%  خره .سكس
2          0.04%  سكس حصان.com/mclient=ms-nokia
2          0.04%  سكس ونيك بنات دنماك
2          0.04%  سكسxxنيك
2          0.04%  سكسجنسي
2          0.04%  سكسكسكسكسكس1
2          0.04%  صور سكس يوغنديه طيذ كبير
2          0.04%  صورsexxxx
2          0.04%  صورجينز بنات نيك جينز سكس
2          0.04%  صورسكس طيز وكس مصرعط
2          0.04%  صورفرنسي سكسي
2          0.04%  صيني فيديوشيميل
2          0.04%  عربسکس
2          0.04%  عربسکس مباشر
2          0.04%  فيدوحصان سكس نسوان نس
2          0.04%  فيديوسكس2011
2          0.04%  فيديوشميل سكس نيك هندى
2          0.04%  مشاهدةافلام جولدبورن مصرى
2          0.04%  مقاطع فيديوسكس2
2          0.04%  مقاطعsex-edusa
2          0.04%  موزيلاسكس
2          0.04%  موقع تاكسي9 للسكس
2          0.04%  نساالجمیل
2          0.04%  نيج @com
2          0.04%  يوتيوبhttp://www.tubeforwork.com/movies/celebrity1.shtml
2          0.04%  ‫الكويت @hotmail.kw @yahoo.kw @gmail.kw 2013
1          0.02%  % email contact guest book @yahoo.com @hotmail.com @aol.com 2013 txt
1          0.02%  %%%%%%@robert.yahoomail.gmail.aol
1          0.02%  %100 project@hotmail.com investor@earthlink.net % funding@aol.com
1          0.02%  %d8%a1%d9%89%d8%a1%d8%a1 %d9%86%d9%8a%d9%83 %d8%aa%d9%88%d8%a8%d9%88%d9%84
1          0.02%  %d8%a7%d8%ae%d8%a8%d8%a7%dافلام عربى سكس8
1          0.02%  %hady@aol.com @gmail.com@yahoo.com txt
1          0.02%  %ةافلام سكس
1          0.02%  ''exporter and importer'''' precious stones ''@gmail.com ae.com 163.com @yahoo.com @hotmail.com''2013
1          0.02%  ''lee'' @hughes.net '' '' '' @web.de'' ''@bigpond.com
1          0.02%  'txt' china manufacturing companies in china and export and importer @sina.com.cn @163.com @126.com @263.net
1          0.02%  ( 208) antony @hotmail.casouthbell.net@rocketmail.com@yahoo.ca xls
1          0.02%  ( 671 emails @att bellsouth ymail yahoo rocket sbcglobal in qatar(txt
1          0.02%  ( cassie miller ) @gmail
1          0.02%  ( sailors managers bankers @att bellsouth ymail yahoo rocket sbcglobal in asia(txt
1          0.02%  ((((@@@@)))) mexico @yahoo.com @hotmail.com @gmail.com @aol.com txt
1          0.02%  (86) china engine distributors/guestbook yahoo.cn xis
1          0.02%  (stellarphillip@yahoo.com)
1          0.02%  (xls) sheet1 @upcmail.nl
1          0.02%  **************** mongolia @msn.com@live.com@hotmail.com-
1          0.02%  ****@mweb.co.za %. csv txt 2013
1          0.02%  ***10 txt lee@hotmail.com@aol.com@yahoo.com in 2013
1          0.02%  -
1          0.02%  . dadkam caina school garl sax
1          0.02%  ...... maktoob.com asiamail.com arabic.com.au arabic.com.my txt
1          0.02%  ..horse. mobile 20012 xxxhorse. teen 20012 xxxhorse. anal 20012 ...
1          0.02%  .com//txt/thomas/@yahomai!
1          0.02%  .comz zux
1          0.02%  .http://search.yahoo.com/searchp=.bbbbbvvvvvvvvsdd
1          0.02%  .india sex vidieo
1          0.02%  .saudi arab vdeo
1          0.02%  .www. bf .yaho com
1          0.02%  .wwwxvideos c.ronaldo.com.br
1          0.02%  .سكس أمريكي2013
1          0.02%  .سكس امريكاي
1          0.02%  .سكس امهات
1          0.02%  .سكس بنجالي
1          0.02%  .سكس حمير
1          0.02%  .سكس حيوا ني
1          0.02%  .سكس شيمل
1          0.02%  .سكس فيدو حصان موبايل
1          0.02%  .سكس كس يا بنى كس
1          0.02%  .سكس كويتى
1          0.02%  .سكس نيك حمير مع بنى ادمين طحن
1          0.02%  .سكس يواغندي
1          0.02%  .سكس گروهي
1          0.02%  .‎‏.سكس أفلام عربيcom
1          0.02%  0.12% 2012/13 email contactes of ali in south korea yahoo.com
1          0.02%  01 4455 213 234buyers@yahoo.com@gmail.com@hotmail.com@aolmail.com
1          0.02%  0°Ð°m
1          0.02%  1 2013 @aol @hotmail @juno @yahoo @comcast @gmail
1          0.02%  1 2013 damain @version.net @comcast net @cox.net
1          0.02%  1 606 joy@aol.ca@yahoo.com@hotmail.com txt
1          0.02%  1 702 contacts informations of fishermen associations members in usa 2013 directory@yahoo.com@aol.com@comcast.net
1          0.02%  1 712 natasha@yahoo.com@aol.com@cox.net@sbcglobal.net
1          0.02%  1 876 famars and county owners in califonia earthlink.net. 2013
1          0.02%  1 @mindspring.com @live.com @charter.net filetype.xls
1          0.02%  1 alice @yahoo.com yahoo.ca hotmail.com 2013 txt
1          0.02%  1 american fishing dealers@aol.com@gmail.com
1          0.02%  1 august 2013 landers email contact information in singapore @yahoo.sg@gmail.com
1          0.02%  1 canada @ymail.comgmail.commail.comhotmail.com
1          0.02%  1 canadian job seekers @yahoo.com @hotmail.com @gmail.com @aol 2013
1          0.02%  1 ceo.xls @hotmail.de @gmail.com @yahoo.ca
1          0.02%  1 company emails importer exporter @yahoo @gmail @hotmail
1          0.02%  1 contacts @aol.com @sbcglobal.com @yahoo.com @hotmail.com txt 2013
1          0.02%  1 csv jude@bellsouth.net. 2013 txt
1          0.02%  1 current email address form companies in yahoo com gmail com hotmail 126 in united states of america scam
1          0.02%  1 daniela @yahoo gmail com hotmail com live com comcast com txt 2013
1          0.02%  1 ebb@yahoo.com @izitocom @aol.com @msn.com @gmx.com @att.net @gmail.com @hotmail.com xls
1          0.02%  1 email guest book in usa @yahoo.com@wanadoo.fr@aol.com 2008 or 2009 or 2010
1          0.02%  1 eric @earthlink.net aol.com hotmail.com %2013 txt
1          0.02%  1 fabric machines companies @yahoo.com @gmail.com @hotmail.com @yahoo.co.uk @aol.com @2013
1          0.02%  1 james @yahoo.com @msn.com @gmail.com @aol.com 2013
1          0.02%  1 jessica @rocketmail.com @yahoo.com @gmail.com @hotmail.com 2013
1          0.02%  1 john @@@aol.com @@@gmail.com list 2013 .txt
1          0.02%  1 joy @yahoo com@hotmail com@gmail com@aol com2013
1          0.02%  1 july 2013 @yahoo.com @hotmail.com @gmail.com @telus.net @verizon.net .txt
1          0.02%  1 jun 2013 ... 1usa@ yahoo.com@ hotmail .com@ gmail.com@aol.com 4 0.06% 2013 email addresses of nigeria
1          0.02%  1 maryanne @juno.com @aol.com @hotmail.com @comcast.nt @sbcglobal.net txt
1          0.02%  1 melissa@aol.com @gmail.com @juno.com
1          0.02%  1 michael yahoo com filetype txt 2013
1          0.02%  1 richard @gmail.com@yahoo.com@hotmail.com txt 2013
1          0.02%  1 roland walter @yahoomail @hotmail @gmail
1          0.02%  1 south @yahoo.ca txt 2013
1          0.02%  1 txt list @gmail.com @yahoo.ca @aol.com @hotmail.com 2013 ...
1          0.02%  1 usa kim@yahoomail.com @gamail.com @hotmail.com @aol.com 2012/2013 txt
1          0.02%  1 yahoo com hotmail com aol com gmail com magdalena scam emails 100 200
1          0.02%  100% deutschland matrimonials dating-site freundschaft
1          0.02%  100% deutschland matrimonials dating-site freundschaft 2013
1          0.02%  100% free friendship penpal and indian asia africamiddle eastsouth america dating site and email address 2013 show all.
1          0.02%  100% hard - xxl sixi 2012 l'algerie - video sexe
1          0.02%  12 gavieta @yahoo.com.au @aol.com @hotmail.com
1          0.02%  12-b/lcwu(9-202)-4377
1          0.02%  123.49.35.79/cm
1          0.02%  125-84.0-85.cust.bluewin.ch
1          0.02%  13 europe or 44 gmail.com@yahoo.com@hotmail.com
1          0.02%  174.66 muslim@webmail@gmail@hotmail
1          0.02%  177.99.134.dynamic.adsl.gvt.net.br
1          0.02%  1774 rice @hotmail.com @yahoo.com @aol.com @ gmail.com txt 2014
1          0.02%  18 angelika amanda@yahoomail.com @gmail.com @hotmail.com @aolmail.com
1          0.02%  1996/ 2000 private businessmen @yahoo @gmail @hotmail @webmail@ ymail @outlook @rediffmail
1          0.02%  1@aol.com@gmail.com@yahoo.com@att.com@juno.com@comcast.com@hotmail.com@rocketmail.com
1          0.02%  1@rockmail@yahoo.com@mail.com37.com@hotmail.com@wwbmail.com
1          0.02%  1@yahoo.com@gmail.com
1          0.02%  1anderson@yahoo.com@gmail.com@hotmail.com@blumail.com@att.net@rocketmail.com@comcast.net@aol.comgmail.com2013
1          0.02%  1angelina@yahoo.com@aol.com @hotmail.com.com@comcast.net
1          0.02%  1anna deaf@aol.com@yahoo.com@comcast.net@blackberry.net@gmai.com
1          0.02%  1benson@aol.com@gmail.com@att.com@juno.com@yahoo.com@comcast.com@hotmail.com@rocketmail.com
1          0.02%  1jack.com@hotmail.com@gmail.com@yahoo.com@oal.com
1          0.02%  1jack.com@hotmail.com@yahoo.com@gmail.com@oal.com
1          0.02%  1mark@gmail.com@yahoo.com
1          0.02%  1murine @yahoo.com@gmail.com@hotmail.com@blumail.com@att.net@rocketmail.com@comcast.net@aol.comgmail.com2013
1          0.02%  1newyork@ymail.comgmail.commail.comhotmail.com
1          0.02%  1sandra@aol.com@yahoo.com@blumail.com@att.net@juno.com@gmailcom@rocketmailcom@comcast.net
1          0.02%  1smith@yahoo.com@gmail.com email txt hotmail filetype 2013
1          0.02%  1susan@yahoo.com@gmail.com@hotmail.com
1          0.02%  1victor@yahoo.com@hotmail.com
1          0.02%  2007 joseph companies or direcors or manager or assistant germany @yahoo.de @msn.com @hotmail.de
1          0.02%  2010 kelly smith germany guestbook @freenet.de @web.de @gmail.com
1          0.02%  2011/2013 email contact of oil dealers in kuwait@yahoo.co.uk
1          0.02%  2012 asian textile exporters emails@163.com emails@gmail.com emails@hotmail.com emails@yahoo.xlsfiles
1          0.02%  2012 email addresses of oil workers in europe @yahoohotmailgmail.com
1          0.02%  2012 email contacts of matthews@laposte.net@yahoo.com@gmail.com@hotmail.com/txt
1          0.02%  2012 qatar exporters email contact list @hotmail.com
1          0.02%  2012 suppliers email directory @gmail.com txt
1          0.02%  2012/2013 chinese chamber of commerce lee_wang@yahoo.com@gmail.com@hotmail.com
1          0.02%  2012>zab_!greg!aol.com!hotmail.com!sha.ca!yahoo.com.au!sbcglobal.net!comcast.net!q.com!
1          0.02%  2013 %@yahoo.com %@hotmail.com% @gmail.com txt
1          0.02%  2013 1@@@yahoo.com @@@gmail.com @@@hotmail.com in usa txt
1          0.02%  2013 49current email list of germany company managers hotmail com yahoo com gmail com aol com sbcglobal net 2013
1          0.02%  2013 64 addison @yahoo.co.nz txt
1          0.02%  2013 78 miners@yahoo.com@rocketmail.com@hotmail.com@comcast.com
1          0.02%  2013 962 yahoo.com hotmail.com gmail.com jaber
1          0.02%  2013 @ derak.derak@hotmail.com christimas.love@yahoo.com filelist.aspx
1          0.02%  2013 @yahoo.com.sg @yahoo.cn @yahoo.com.hk txt
1          0.02%  2013 @yahoo.fr@yahoo.co.kr @hotmail.com.au@gmail.com txt
1          0.02%  2013 __ali_a@hotmail.com in bahrain
1          0.02%  2013 all idaho trade members inc. @hotmail.com @gmail.com @aol.com @comcast.net @gmail.com
1          0.02%  2013 alumni of top chemical company directors in singapore @yahoo.se
1          0.02%  2013 attorney @gmail.com filetype txt
1          0.02%  2013 board of directors @hotmail.com @yahoo.com
1          0.02%  2013 business email addresses of importers exporters traders buyers manufacturers suppliers companies producers of different go
1          0.02%  2013 business men and women @aol.com @sbcglobal.net @yahoo.com @hotmail.com
1          0.02%  2013 businessmen @att.net @aol.com @sbcglobal.net @cox.net @yahoo.com @hotmail.com @verizon.com
1          0.02%  2013 contact email list directory of brig
1          0.02%  2013 current @gmail jp
1          0.02%  2013 current email addresses of nurses in austrailia @yahoo.co.uk @comcast.com
1          0.02%  2013 current email list of world governors@yahoo.com @aol.com @gmail.com @hotmail.com @sbcglobal.net @comcast.net (2013 current
1          0.02%  2013 david @yahoo.com @yahoo.co.uk @gmail.com @hotmail.com @ymail.com @comcast.net traders
1          0.02%  2013 dealers gold in china @comcast.net @hotmail.com @gmail.com @yahoo.com
1          0.02%  2013 directors and companies owners contact email in australia @yahoo.au@hotmail.com
1          0.02%  2013 dringende darlehen. @gmx.ch @aon.com @yahoo.de
1          0.02%  2013 ecm xiv stem and progenitor meeting registration
1          0.02%  2013 egypt trade co.ltd @yahoo.com @hotmail.com @gmail.com
1          0.02%  2013 email address companies jewellers distributors wang@yahoo.com
1          0.02%  2013 email address of ship manufacturers @yahoo.comhotmail.comgmail.com126.com163.com
1          0.02%  2013 email addresses in belarus@sbcglobal.net@comcast.net
1          0.02%  2013 email addresses of belgium glasses factories dealers importers exporters@ymail.com@gmail.com@hotmail.com@yahoo.com@yahoo.c
1          0.02%  2013 email addresses of factories in hongkong @yahoo.com @163.com
1          0.02%  2013 email addresses of nathaniel @aol.comyahoo.com.mxadelphia.netrr.comjuone.combellsouth.nethotmail.com
1          0.02%  2013 email ceo directory ahmed@yahoo.com @sbcglobal.net
1          0.02%  2013 email contacts 97 nick @yahoo.ru
1          0.02%  2013 email contacts of ceo in qatar @ yahoo.com
1          0.02%  2013 email directory guestbook of roger@aol.comyahoo.comtxt
1          0.02%  2013 emails file type:txt@gmail.com@aol.com@hotmail.com@mail.com@yahoo.com@live.com@gmx.com
1          0.02%  2013 emails of ceo in canada@yahoo.com@gmail.com@hotmail.com@rocketmail.com@ymail.com@aol.c
1          0.02%  2013 emails of pastors in iran @yahoo@aol@gmail@hotmail
1          0.02%  2013 emails of top traders on alibaba.com craigslist.com and globalsource.com @hotmail.com
1          0.02%  2013 guestbook of executives @yandex.ru
1          0.02%  2013 guestbook of gold miners in kuwait and europe @yahoo @hotmail @aol and others
1          0.02%  2013 hong @gmail.com filetype html
1          0.02%  2013 hotmaill.com 2013 @yahoo.com -scam
1          0.02%  2013 i am looking oil doctors in kuwait @hotmail@yahoo@gmail
1          0.02%  2013 indonesian business workers and government mens guestbook @yahoo.com @hotmail.com @gmail.com
1          0.02%  2013 job finder@@@cox.net @aol.com @bellsouth.net @yahoo.com @gmail.com @hotmail.com
1          0.02%  2013 job seeker's wanted ads txt@@@@yahoomail.com @aol.com @cox.net @hotmail.com @gmail.com
1          0.02%  2013 kentucky ttading inc. @comcast.net @aol.com @gmail.com @hotmail.com @yahoo.com
1          0.02%  2013 kuma @rediffmail.com @gmail.com txt 2013
1          0.02%  2013 kuwait membership directory current emails @ yahoo.com @gmail.com
1          0.02%  2013 kuwait supplier and sellers email address @ yahoo @gmail @hotmail
1          0.02%  2013 kuwait trade industries market @yahoo.com @hotmail.com @gmail.com
1          0.02%  2013 latvia business trade companies @yahoo.com @mail.com @gmail.com @hotmail.com
1          0.02%  2013 machinery suppliers in china @163.com @126.com
1          0.02%  2013 medical equipment manufacturers 163 com mail com hotmail com trading company @vip.163.com
1          0.02%  2013 meeting of directors in oil sector in saudi arabia and contact email %40hotmail.com
1          0.02%  2013 minnesota trade company listings of products
1          0.02%  2013 qatar exports and imports machines yahomail.com@gmail.com@hotmail.com
1          0.02%  2013 ramirez@yahoo.com @yahoo.com.br @gmail.com @hotmail.com txt
1          0.02%  2013 raymond in canada@hotmail.cayahoo.caaol.cagmail.com
1          0.02%  2013 real estate contractors agents in ukraine fax phone@sbcglobal.net@hotmail.com@oal.com
1          0.02%  2013 registered companies contact email address of ceo'sand fax @aol.com /yahoo/hotmail.
1          0.02%  2013 related email contacts of people in geogis@yahoo.com@hotmail.com@laposte.net/txt
1          0.02%  2013 retired chartered accountant and broker@aol.com@bol.com.br@hotmail.com@uol.com.br
1          0.02%  2013 suppliers/buyers@yahoo.co.jp
1          0.02%  2013 suriname living usa europe and germany @yahoo.com @gmail.com xls
1          0.02%  2013 tah@yahoo.com @hot.com @gmail.com @aol.com
1          0.02%  2013 trade services co.ltd @hotmail.com @yahoo.com @gmail.com @126.com
1          0.02%  2013 united state wholesale traders co ltd @yahoo.com @gmail.com @hotmail.com
1          0.02%  2013 uruguay trade retailers co ltd. @yahoo.com @gmail.com @hotmail.com @mail.com
1          0.02%  2013 usa and china goods exporters @yahoo.com @att.net
1          0.02%  2013 uzbekistan trade ad for sale co. ltd @yahoo.com @gmail.com @hotmail.com @mail.com
1          0.02%  2013 xls manufacturing of rods 86 @yahoo.com import and export contact list
1          0.02%  2013 xls manufacturing of tyres 885 yahoo com import and export contact list
1          0.02%  2013@yahoo.com@hotmail.com@gmail.com
1          0.02%  2013email leads@yahoo @hotmail @gmail pdf
1          0.02%  2013emails @yahoo.com @web.de @hotmail.com @aol.com
1          0.02%  202 @hotmail.eg kahn
1          0.02%  202 @yahoo.eg kahn
1          0.02%  213 email contact of manufacturers and distributors @yahoo @hotmail. @gmail dz algeria xls
1          0.02%  213 oena 96 mohamed@webmail@hotmail@yahoomail
1          0.02%  21food.com sellers in abu dhabi @hotmail.com @eim.ae -spam/scam/fraud
1          0.02%  233 topen@yahoomail @gmail @hotmail @aol-scam
1          0.02%  234 ade@webmail@yahoo@gmail.com.nig
1          0.02%  234 cement exporters @yahoo.com@gmail.com @126.com@123.com@hotmail
1          0.02%  234 emeka @yahoo.com @gmail.com @hotmail.com @live.com vtc
1          0.02%  234 foreign building compains in nigeria
1          0.02%  234 metals suppliers llc @yahoo.com .xls xls
1          0.02%  234 raw material suppliers buyer company @gmail.com.ng
1          0.02%  234@hotmail.comassociation doctors 2o13
1          0.02%  249 current email address form companies in @yahoo com @gmail com @hotmail @126 in sudan- scam in 20/13
1          0.02%  263@yahoo.com@aol.com@gmail.com@hotmail.comtxt2013
1          0.02%  264 magdalena@webmail@yahoomail@gmail.na
1          0.02%  265 nederland @webmail@yahoomail@gmail
1          0.02%  27 @yahoo com gmail com rocketmail com txt 2013
1          0.02%  27 food suppliers and manufacturers @yahoo or @hotmail or @gmail or @live or @163.com or @126.com suppliers and manufacturersoo
1          0.02%  27@yahoo.co.za@hotmail.co.za@gmail.za txt2013
1          0.02%  281 (lybia)_haziz @gmail.com
1          0.02%  2@yahoo @gmail @ymail @rocketmail addresses of people seeking for jobs
1          0.02%  3 skeletal fractures that can be repaired
1          0.02%  30 @otenet.gr @hotmail.gr
1          0.02%  31/fax/yahoomail yahoomail/gmail com 2011/2012/2013
1          0.02%  31@gmail.com@yahoo.com.uk@hotmail.com@aol.com@ymail.com2013
1          0.02%  33 crystal company's and manufactuer yahoo hotmail gmail 126 163
1          0.02%  33 weevon company's and manufacture yahoo hotmail gmail 126 163
1          0.02%  33live.com gmail.com yahoo.it aol.com txt
1          0.02%  34 @yahoo.cn @gmail.com @hotmail.com @qq.com steel producers in europe 2013
1          0.02%  34 chemical producing companies sales/import and exports of product @gmail.com @163.com @sina.com @yahoo.com @rocketmail.com @s
1          0.02%  34 kenneth yahoo.com 2012 axls
1          0.02%  351 suppliers @yahoo.com@hotmail.com@gmail.com@oal.com
1          0.02%  359 contact bulgaria industries companies@ gmail.info
1          0.02%  37 board of directors @gmail.com @cs.com @yahoo.com @gmail.com
1          0.02%  38email l l c tt@googie.com.gh
1          0.02%  3d culture for bone formation
1          0.02%  3d culture systems were used to mimic ecm in vivo
1          0.02%  3d spheroids mesenchymal
1          0.02%  3gp arbab servent xxx mobi com
1          0.02%  409 executives @yahoo.com aol.com gmail.com xls 2013
1          0.02%  41 @yahoo.com switzerland
1          0.02%  41@gmail.ch @yahoo.ch @hotmail.ch @aol.ch txt
1          0.02%  41oil manufacturers contact yahoo com gmail com hotmail com txt scam
1          0.02%  420 director owner manufacturers and exporters of generators@cz@yahoo.com@@hotmail.com
1          0.02%  420 seafood importers and exporters @yahoo.cz @hotmail.cz @gmail.cz
1          0.02%  420wap.com/dow/index.phpdir=load/world sex videos/african sex
1          0.02%  421slovak email directroy 2013
1          0.02%  43 ministers @hotmail.de @yahoo.de
1          0.02%  43 oil companies in austria @gmail @yahoo.com
1          0.02%  44 @gmail.com @yahoo.comtxt
1          0.02%  44 elizabeth @hotmail @gmail @yahoo @aol.com--------------2013
1          0.02%  44 smith p.o.box directories @yahoo.com @aol.com @gmail.com @hotmail.com 2013
1          0.02%  44@@@@@yahoo.com@@@@@hotmail.com@@@@@gmail.com@@@@@aol.com@@@@@.txt
1          0.02%  44jack.com@hotmail.com@yahoo.com@gmail.com@oal.com
1          0.02%  45 denmark executives yahoo com gmail com hotmail com 2013 2014
1          0.02%  456 hotmail com alocom net com engineerings doctors
1          0.02%  46 chemicals manufacturing companies in europe@yahoo.com @hotmail.com
1          0.02%  46 current companies email address in yahoo com gmail com hotmail 126 in sweden scam
1          0.02%  46 philip@yahoo.com @hotmail.com @live.com @gmail.com 2013
1          0.02%  49 67company @yahoo.com
1          0.02%  49 @gmail.com @alomail.com @yahoo.com @webmail.com @hotmail.com
1          0.02%  49 @yahoo.com @hotmai.com@gmail.com 2013
1          0.02%  49 @yahoo.de @gmx.de @yahoo.com @gmail.com @hotmail.com 2012/2013 xls
1          0.02%  49 andreas @yahoo.com @aol.com @comcast.net -2/22/2012
1          0.02%  49 arthur@yahoo.com. address@hotmail.com. germany
1          0.02%  49 directory of car engine @yahoo.com.cn or @163.com filetype:html
1          0.02%  49 germany trading alibaba gmail com yahoo com hotmail com
1          0.02%  49 manufacturers buyers sellers rice @yahoo.com.de @hotmail.com.de @gmail.com @gmx.de
1          0.02%  49 mÜller email list @yahoo.de
1          0.02%  49importers hotmail com yahoo com xls file
1          0.02%  49kelvin@gmail.com@yahoo.com
1          0.02%  4shared.com @earthlink.com.hk
1          0.02%  4x vedio sixy naij gal .u.a.e
1          0.02%  5/miller@aol.com @yahoo.com 2010 to 2013 only.
1          0.02%  5000 @hotmail@yahoo.com@gmail.com@163.com importers and exporters email addresses
1          0.02%  52 kim @yahoomail.com @gamail.com @hotmail.com @aol.com 2012/2013 txt
1          0.02%  54 gmail.comhotmail.armarketer
1          0.02%  54 gmail.comhotmail.mxmarketer
1          0.02%  54 torres @ yahoo.com.ar @ gmail.com @hotmail.com typefile:txt
1          0.02%  55 213 234buyers@yahoo.com@gmail.com@hotmail.com@aolmail.com
1          0.02%  55 carlos contact email @yahoo.br @gmail.com.mx 2013
1          0.02%  55 richard @yahoo.com 2013 .txt
1          0.02%  55@ contractors@ pty ltd@ yahoo.com.br@hotmail.com.br@aol.com @2013 email directories
1          0.02%  55brazilbuyers from china mails@yahoo.com@gmail.com@hotmail.com
1          0.02%  55jim @yahoo.com@aol.com@hotmail.com oil company
1          0.02%  55williams@gmail.com @yahoo.com @aol.com @hotmail.com
1          0.02%  56 @yahoo.cn @gmail.com @hotmail.com @qq.com steel manufacturers in china
1          0.02%  590 sankyo 2013 email@yahoo.com.net
1          0.02%  60 @yahoo.com @gmail.com @hotmail.com @aol.com @sbcglobal.com 2013
1          0.02%  60 agricultural products @hotmail.com@yahoomail.com.my@aol.com@gmail.com@yahoomail.com 2013
1          0.02%  60 medical equipments companies and manufacturer yahoo hotmail gmail 126 163
1          0.02%  60 omar @yahoo.com.my @gmail.com @hotmail.com @yahoo.com 2013
1          0.02%  601 hans @yahoo.com.sg @gmail.com @hotmail.com
1          0.02%  61 @aol.com @hotmail.com ali 2013
1          0.02%  61 @mexicocityfeis.com @verizon.net @comcast.net @hotmail.com @aol.com @yahoo.com @gmail.com txt
1          0.02%  61 @yahoo.com @hotmail.com @gmail.com @mail.com txt
1          0.02%  61 brown 2013 current email contact @yahoo.jp@yahoo.edu@yahoo.sa@gmail.com
1          0.02%  61 email pvt company manufacturers sales suppliers@hotmail.com
1          0.02%  61 imail distributors suppliers companies oal com
1          0.02%  61 james@gmail.com.au @mail.com.au @aol.com directors 2013
1          0.02%  61 judy joan carol hasan mark mary smith alex morgan anna cindy anita henry relmond james juliet yahoo.com gmail.com hotmail ao
1          0.02%  61 loan au au optusnet com au scam
1          0.02%  61 mary @yahoo.com.au @gmail.com @aol.net 2013 txt
1          0.02%  61 mary i need an urgent loan @yahoo.au ***** @hotmail.au txt
1          0.02%  61 oil and gas email contact @yahoo.com 2013
1          0.02%  61 rev rosemary hotmail com cox net gmail com 2014
1          0.02%  61@judy joan carol hasan mark mary smith alex morgan anna cindy anita henry relmond james juliet yahoo.com gmail.com hotmail ao
1          0.02%  61@optusnet.com.au@bigpond.com.au@aol.com@yahoo.com@gmail.com.au@hotmail.com.au in 2013
1          0.02%  61elizabeth@yahoo.com.au@gmail.com@aol.com@cox.net txt
1          0.02%  62 2013 pvc sellers and manufacturers @@yahoo @@gmail
1          0.02%  62 @aol.com@hotmail.com@msn.com@yahoo.com@cox.net 2013
1          0.02%  62 cars all new suppliers llc @yahoo.com .xls xls
1          0.02%  62 dr arik @hotmail.com @cox.net @att.net
1          0.02%  62 indonesian woman association email list @yahoo.co.id
1          0.02%  62 lee@hotmail.com txt 2013
1          0.02%  62 seafood manufacturer and export and import their yahoo hotmail gmail full text
1          0.02%  623 @sbcglobal @hotmail @yahoo.com.jp txt
1          0.02%  62txtemil.ceramicstrading@yahoo.com@hotmail.com@sbclobal.nettxt
1          0.02%  63 2013 pvc sellers and manufacturers @@yahoo @@gmail
1          0.02%  63 maxwell yahoo.com 2012 axls
1          0.02%  63.....................@aol.com@hotmail.com@comcast.com@hotmail.com.............txt
1          0.02%  64 @gmail.com 2013 contacts of company directors in australia txt
1          0.02%  64 @yahoo.com @hotmail.com @msn.com @earthlink.com @aol.com @freenet.de txt2013
1          0.02%  64 aata @yahoo.co.nz txt
1          0.02%  64 austine@yahoo.com @gmail.com @hotmail.com @live.com xls
1          0.02%  65 hussain @hotmail @sympatico @msn @live txt 2012 --
1          0.02%  65 singarpore @yahoo.com @gmail @hotmail @aol-------------2013
1          0.02%  65 zafran @yahoo.com.sg @hotmail.com @gmail.com 2013 txt
1          0.02%  67 chemicals company's and manufactuer yahoo hotmail gmail 126 163
1          0.02%  67 gmail.com.yahoo.com.hotmail.com
1          0.02%  69 @aol.com @gmail.com @cox.net 2013
1          0.02%  69 cy doctors @hotmail.com @@yahoo.com txt 2011
1          0.02%  7 electronic
1          0.02%  7 john @yahoo.com @gmail.com @hotmail.com @comcast
1          0.02%  70/newb.b2@gmail.com @yahoo.fr @hotmail.com @aol.com
1          0.02%  77 manufacturing companies @bigpond.com % @yahoo.com.au % @hotmail.com % @gmail.com % @aol.com % @comcast.net 2013 txt
1          0.02%  786 @yahoo.com@hotmail.comgmail.com txt
1          0.02%  81 62 61 chan contact e-mails 2013@hinet/hotmail/yahoo.com
1          0.02%  81 965 34 email contact of import and exports companies @hotmailcom @gmail.com @163.com @sina.com @yahoo.com @rocketmail.com @s
1          0.02%  81 china @yahoo.com @hotmail.com
1          0.02%  81 japan seafood suppliers @yahoo.com .xls xls
1          0.02%  81 treading companies@ (sblc) bg @gmail.com
1          0.02%  81@yahoo.com@hotmail.com@aol.com@gmail.com@verizon.net@comcast.nettxt2013
1          0.02%  81farmers in japan personal email address nkem@brhrkf.com@tokur@mail.koc.net 20112012
1          0.02%  82 kwang @gmail.com txt
1          0.02%  82 south korea chu@yahoo.com @hotmail.com @gmail.com @aol.com @yahoo.co.uk @hanmail.com @yahoo.in @yahoo.id
1          0.02%  84@gmail.com
1          0.02%  84_nguyen@yahoo.co.vn company emails
1          0.02%  85 chen @126.com email/csv/txt
1          0.02%  852 construction company ceo xls or pdf or txt or doc aol.com
1          0.02%  852 power and energy ceo xls or pdf or txt or doc aol.com
1          0.02%  852@yahoo.com.hk@163.com@yahoo.com''xls2013.
1          0.02%  855 email contact of buyer seller@yahoo @hotmail @gmail kh cambodia xls
1          0.02%  86 2013 email database of traders in asia @163.com @126.com @hotmail.com
1          0.02%  86 @163.com @yahoo.in @hotmail.com txt 2013
1          0.02%  86 @hotmail.cn cheng
1          0.02%  86 @hotmail.cn hu
1          0.02%  86 @hotmail.cn pan
1          0.02%  86 @hotmail.cn wu
1          0.02%  86 beverage company manufacturer@yahoo.com@gmail.com@hotmail.com@126.com@136.com
1          0.02%  86 buyers and sellers of laptops @yahoo.cn @gmail.com @hotmail.com
1          0.02%  86 buyers of transformers in china company @gmail.com.cn @hotmail.cn
1          0.02%  86 car part product suppliers in china@yahoo.com@hotmail.com@163.com@126.com
1          0.02%  86 cement company @yahoo.com@hotmail.com@gmail.com@126.com@163.com 2013
1          0.02%  86 chemical suppliers and manufacturer @yahoo.com.cn @126.com @163.com @hinet.net
1          0.02%  86 china steel manifacturers @163.com @yeah.net @yahoo.cn txt
1          0.02%  86 electrical sellers @yahoo.cn @126.com
1          0.02%  86 farmers @yahoomail@hotmail @gmail 2012/2013
1          0.02%  86 jane importer exporter company emails @yahoo.com
1          0.02%  86 judy joan carol hasan mark mary smith alex morgan anna cindy anita henry relmond james juliet yahoo.com gmail.com hotmail ao
1          0.02%  86 manufactures contact sales email address @yahoo.cn @qq.com @126.com @163.com @hotmail.com
1          0.02%  86 manufacturing company @yahoo.cn @yahoo.com @gmail.com @hotmail @aol
1          0.02%  86 mechanical parts suppliers yahoo com cn yahoo cn hotmail com gmail com 163 com 126 com
1          0.02%  86 oil and gas machinery manufacturers company in china@yahoo.com.cn @hotmail.com
1          0.02%  86 oil company @yahoo.com@hotmail.com@gmail.com@126.com@163.com 2013
1          0.02%  86 plastic exporters@yahoo.com @gmail.com @126.com @qq.com
1          0.02%  86 producers and exporters of industrial chemical in iran @yahoo.com @hotmail.com @gmail.com @aol.com @earthlink.comoo
1          0.02%  86 shang@yahoo.com.cn@inbox.com@hotmail.com@ramble.com
1          0.02%  86 spareparts suppliers and manufacturers @yahoo.com.cn @126.com @163.com @hinet.net
1          0.02%  86 suppliers and importers video games@yahoo.com@gmail.com@163.com@hotmail.com
1          0.02%  86 tiles manufacturing companies@yahoogmailhotmail.com
1          0.02%  86 tractor suppliers @yahoo.cn @gmail.cn @live.cn @hotmail.cn @outlook.cn
1          0.02%  86 trade lead suppliers@yahoo.cn 2013
1          0.02%  86// china paper latest email directory hotmail yahoo.com.cn xis
1          0.02%  861@yahoo com @ymail.com @yamil.com.au @yahoo.hk @yahoo.co.jp
1          0.02%  866/lin/ @livemail.tw e-mail.txt /emails 2013
1          0.02%  86@yahoo.ch @aol.comtxt2013
1          0.02%  86@yahoo.ch@gmail.com@hotmail.com@msn.com txt.csv.xls ''2013''
1          0.02%  86rachael@yahoo.commanufacturing companies import and exports of raw materials
1          0.02%  880 garments leather products manufacturers suppliers ltd @yahoo.com @hotmail.com bangladesh slx
1          0.02%  885 edward hotmail com yahoo com gmail com sbcglobal net 88 mohammed @yahoo.com @rediffmail.com @gamil.com @hotmail.com @rockma
1          0.02%  886 (taiwan companies) *yahoo.com.tw *hotmail.com *gmail.com *pchome.com.tw
1          0.02%  886rachael@yahoo.com import and exports of plumbing materials
1          0.02%  886taiwan rods @hotmail.com or yahoo.com.tw --hoax
1          0.02%  89@gmail.com@yahoo.com.uk@aol.com@ymail.com 2013
1          0.02%  89china fashion wear suppliers@gmail.com xls
1          0.02%  89china jewelries manufacturing‎ companies @gmail.com
1          0.02%  89cnm
1          0.02%  90 türkiye import export trade merchant email tel fax @yahoo.com.tr
1          0.02%  90% yahoomail.com gmai.com hotmail.com aol.com outlook.com
1          0.02%  90001 larry @yahoo.com @hotmail.com @aol.com 2013.txt
1          0.02%  90001 mikel@yahoo.com @hotmail.com @aol.com 2013.txt
1          0.02%  90001@aol.com@aim.com@sbcglobal.net@comcast.netmsn.com@hotmail.com@gmail.com@att.net@rr.comearthlink.net
1          0.02%  90001@yahoo.com@gmail.com@hotmail.com
1          0.02%  9000@yahoo.com
1          0.02%  90tukey@yahoo.co.tk
1          0.02%  91 drugs sellers @vsnl.com @yahoo.co.in
1          0.02%  91 drugs suppliers @vsnl.com @gmail.com
1          0.02%  91 email producers and suppliers2013@aol.com
1          0.02%  91 helen @aol.com rediffmail.com yahoo.co.in
1          0.02%  91 india @yahoo.com @gmail @hotmail @aol-------------2013
1          0.02%  91 txt traders members 2013 list @yahoo.in@gmail.com@hotmail.co
1          0.02%  91kuma@yahooin .rog
1          0.02%  91salerspkbuyerspkimporterspkexporterspkgmail.compkhotmail.compkyahoo.compkpakistansalers
1          0.02%  92 companies @bigpond.com % @yahoo.com.au % @hotmail.com % @gmail.com % @aol.com % @comcast.net 2012 txt
1          0.02%  92 companies @gmail yahoo 2011/ 2013
1          0.02%  92 mushood @gmail.com @yahoo.com @hotmail.com..rediffmail.com
1          0.02%  92 pakistan seafood suppliers llc @yahoo .xls
1          0.02%  92 sales company emails in pakistan @yahoo.com @hotmail.com :txt
1          0.02%  92 seafood suppliers llc @yahoo.com .xls xls
1          0.02%  92 suppliers of textiles @yahoo.com @cyber.net.pk @vsnl.com
1          0.02%  920100 restate investor aol com hotmail fr live con yahoo com hk 2013
1          0.02%  922 fish @yahoo.com @hotmail.com @msn.com @comcast.net
1          0.02%  92yahoo.com list of company/importer/exporter
1          0.02%  93 @yahoo.com @hotmail.com @aol.com
1          0.02%  963 mohanad 2013 current email contact @yahoo.jp@yahoo.edu@yahoo.sa@gmail.com
1          0.02%  964 @yahoo.com current email address of car dealers in iraq
1          0.02%  964 fresh seafood suppliers llc @yahoo .xls xls
1          0.02%  964iraqkazim@yahoo.com.ahmed@hotmail.com
1          0.02%  965 adulahi @mail.com @gmail.com @hotmail.com txt
1          0.02%  965 ali@mail.com @gmail.com @hotmail.com @live.com 2013
1          0.02%  965 board roster @yahoo.kw ceo/owner.pvt lane
1          0.02%  965 business import and export @yahoo.com @gmail.com @hotmail.com @2013
1          0.02%  965 hassan directory yahoohotmailgmailaol 2013
1          0.02%  965 importers of building materials in kuwait @yahoo.com.hk @hotmail.com.hk @yahoo.com
1          0.02%  965 judy joan carol hasan mark mary smith alex morgan anna 86 judy joan carol hasan mark mary smith alex morgan anna cindy anit
1          0.02%  965 kuwait @gmail.com @yahoo.com @hotmail.com @verizon.net @comcast.com @sbcglobal.net
1          0.02%  965 kuwait oil suppliers @yahoo *@hotmail
1          0.02%  965 producers buyers sellers golds @yahoo.com.kw @gmail.com.kw @hotmail.com.kw
1          0.02%  965 pvt.co.ltd oil and gas trades in kuwait @yahoo.kw e-mail/fax
1          0.02%  966 965 962 974 oil or investors or email or list or 2013 @yahoo.com@hotmail.com@gmail.com
1          0.02%  966 @yahoo.com @hotmail.com @gmail.com
1          0.02%  966 @yahoo.com @hotmail.com @gmail.com ali saudi arabia
1          0.02%  966 @yahoo.com @hotmail.com @gmail.com mary saudi arabia
1          0.02%  966 @yahoo.fr@aol.com@cox.net@excite.com@gmail.com@hotmail.com
1          0.02%  966 abdalmalek p.o.box directories @aol.com @gmail.com @yahoo.com @hotmail.com 2013
1          0.02%  966 mamud @yahoo.com @hotmail.com @gmail.com @live.com 2013
1          0.02%  966 oil company in saudi arabia@yahoo.com@hotmail.com
1          0.02%  966 sammy @aol.
1          0.02%  966 saudi @yahoo.com @hotmail.com @gmail.com 2013
1          0.02%  966 saudi arabia engineering free emails @yahoo.com hotmail.com @ymail.com
1          0.02%  966 the richest saudi @yahoo.com @hotmail.com @gmail.com @mail.com txt
1          0.02%  966@hotmail.com 2013
1          0.02%  966@hotmail.com mohammad
1          0.02%  966khan@hotmail.com.@yahoo.com
1          0.02%  96سكس
1          0.02%  97 emails of rice companies@yahoo.com@gmail.com@163.com@hotmail.com 2013
1          0.02%  97 fabric producers and buyers @yahoomail.com @hotmail.com @gmail.com@ 126.com @163.com 2013
1          0.02%  97 pastor and rev mails in 2013@yahoo.fr
1          0.02%  971 ceo email company @hotmail com 2013
1          0.02%  971 hussein@hotmail.com.ae@yahoo.co.ae
1          0.02%  971 ismail united arab emirates 2010 @yahoo.com @aol.com @gmail.com @hotmail.com
1          0.02%  971 uae @gmail.com @yahoo.com @hotmail.com @verizon.net @comcast.com @sbcglobal.net
1          0.02%  971@
1          0.02%  971@yahoo com list of businessmen dubai 971 yahoo
1          0.02%  972kuwaite oil dealers @ wed.de @ yahoo.com @ gmx.de @ aol/2013de @ onlien.de
1          0.02%  973 @yahoo.com @hotmail.com @gmail.com arif saudi arabia
1          0.02%  973 abdulaziz @yahoo.com hotmail.com ltdl
1          0.02%  974 email fax/tel officesaddress@com @qa factory workers@
1          0.02%  974saadi@yahoo.comhotmail.com@gmail.comtxt
1          0.02%  975 sblc brokers in ltd yahoo com hotmail com gmail com 20 08 2013
1          0.02%  98 distributors suppliers @gmailcom
1          0.02%  98% email lists of business expo @aol gmail telus
1          0.02%  98001@yahoo.comaol.comhotmail.comgmail.com
1          0.02%  986 company directors @yahoo@hotmail filetype;xls
1          0.02%  :.ru list email/txt/
1          0.02%  :txt intext:@gmail intext:facebook intext:password
1          0.02%  @2012 ....@web.de.... @yahoo.de... @yahoomail.com.... @hotmail.de.... @gmail.som.... @facebook.com
1          0.02%  @2013 @@engineers@@ @hotmail.com or @gmail.com or @gmail.com or @aol . com txt
1          0.02%  @@@@ michael @yahoo.com txt
1          0.02%  @@@@ yahoomail.com gmail.com att.net hotmail.com % ```~~~~ spam
1          0.02%  @@@mathew@msn.com@gmail.com@bellsouth.net@comcast.net filetype: xls
1          0.02%  @@yahoo.co.au @@hotmail.com @gmail.com @comcast.com @zimbra.com filetype txt
1          0.02%  @@yahoo.com @@hotmail.com @@aol.com @@charter.net @@comcast.net -
1          0.02%  @akzonobel.com.pk xls 2013
1          0.02%  @alexander.ru @yahoomail.com txt 2013
1          0.02%  @aol @comcast @hotmail @gmail @yahoo 2013
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @126 @163 . ... @gmail.com 2013 manufacturers and dealers of ... computer and laptop sales
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @bk @mail
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @globo @terra @uol @bol
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @gmail @terra
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @live @hotmail @126 @163
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @mail @open @tut @gmail
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @mail @yandex @bk @rambler
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @mail @yandex @bk @ya @index @list
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @mail.com @email.com
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @r7
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @rambler.ru @mail.ru @ukr.net
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @seznam
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @sg
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @uol @r7 @ig @facebook
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @uol @terra @ig
1          0.02%  @aol @comcast @hotmail @gmail @yahoo @ymail
1          0.02%  @aol @comcast @hotmail @gmail @yahoo marketing
1          0.02%  @aol @comcast @hotmail @gmail @yahoo.my
1          0.02%  @aol @comcast @hotmail @gmail @yahoogreen@acesee.com
1          0.02%  @aol @comcast @hotmail @yahoo @gmail @live
1          0.02%  @aol @gmail @hotmail farmers email leads in dubai and singapore
1          0.02%  @aol @hotmail @gmail @yahoo
1          0.02%  @aol @uol @yahoo @bol @terra
1          0.02%  @aol @wanadoo @hotmail @gmail @yahoo
1          0.02%  @aol.com @verizon.net @msn.com @hotmail.com @yahoo.com 2013 email addresses of plastic and rubber companies in korea
1          0.02%  @aol.com @verizon.net @msn.com @hotmail.com @yahoo.com 2013 email addresses of steel companies in bangladash
1          0.02%  @aol.com @verizon.net @msn.com @hotmail.com @yahoo.com 2013 email addresses of steel companies in the world
1          0.02%  @aol.com @verizon.net @msn.com @sbcglobal.com @yahoo.ca @hotmail.com 2013 email addreses of boat building companies in china
1          0.02%  @aol.com @verizon.net @sbcglobal.com @yahoo.ca @msn.com @hotmail.com 2013 email addresses of lumbering companies in korea
1          0.02%  @aol.com.bh @comcast @hotmail.com.bh @gmail.com.bh @yahoo.com.bh
1          0.02%  @aol.com@gmail.com@yahoo.com@btinternet.com@bellsouth.net txt
1          0.02%  @aol@ymail@hotmail@gmail.com
1          0.02%  @arabic ronaldo_7
1          0.02%  @bigpond.au galvanized pipe
1          0.02%  @bigpond.net.au @gmail.com @hotmail.com txt
1          0.02%  @bol @ terra @uol @hotmail @gmail @yahoo
1          0.02%  @com.sa hydraulic hose
1          0.02%  @dodo.com.au sellers miguel -csv
1          0.02%  @email for i phones dealers for sale in usa@ aol.com
1          0.02%  @freenet.de optusnet.com.au smtp 4shared
1          0.02%  @gamail o como es
1          0.02%  @glv.co.za
1          0.02%  @gmail @yahoo @mail.ru
1          0.02%  @gmail.com @aol.com @hotmail.com @embarqmail.com victor pastebin or 2013 addresses
1          0.02%  @gmail.com @bol.com.braxt:txt
1          0.02%  @gmail.com @ig.com.br ext.txt
1          0.02%  @gmail.com @uol.com.braxt:txt
1          0.02%  @gmail.com @webmail.com @hotmail.com @yahoo.com @ymail.com @gmx.com @rocketmail.com
1          0.02%  @gmail.com @yahoo.com @hotmail.com
1          0.02%  @gmail.com @yahoo.com.au @cox.com @att.com @iinet.net.au @bigpond.com
1          0.02%  @gmail.com.om @omantel.net.om cement factories
1          0.02%  @gmail.comsbcglobal.netanimail.net nobert johnson -robertson 50..100
1          0.02%  @gmail.pl @yahoomail.pl @mail.pl @aol.pl txt2013
1          0.02%  @gmil .com
1          0.02%  @gomail
1          0.02%  @google x videos.com-sexboys hard fuck
1          0.02%  @hotmail @aolmail @yahoomail @gmail
1          0.02%  @hotmail @gmail @live
1          0.02%  @hotmail @gmail @yahoo @google
1          0.02%  @hotmail @gmail @yahoo @live.cl
1          0.02%  @hotmail @gmail @yahoo @uol @r7.com @live.com
1          0.02%  @hotmail @yahoo @gmail china
1          0.02%  @hotmail @yahoo @outlook.com @outlook.com.br @live
1          0.02%  @hotmail ext: txt
1          0.02%  @hotmail importers and exporters in hong kong
1          0.02%  @hotmail it @yahoo.it @gmail.it .2012.txt
1          0.02%  @hotmail. @aol.com @comcast.net @hotmail.com @bellsouth.netof david john frank wyane howard jam
1          0.02%  @hotmail.ch @msn.ch
1          0.02%  @hotmail.co.ch @yahoo.com.ch @gmail.com
1          0.02%  @hotmail.com @comcast asia director txt
1          0.02%  @hotmail.com @gmail.com @yahoo.com terra.com
1          0.02%  @hotmail.com @outlook @gmail.com ext.txt
1          0.02%  @hotmail.com @widowslive.com @live.com @outlook.com @msn.com 2013 @china
1          0.02%  @hotmail.de @live.de @msn.de
1          0.02%  @hotmail.nl @yahoo.nl @gmail.nl 2013
1          0.02%  @ig @hotmail @gmail @yahoo
1          0.02%  @juno.com @rogers.com @bigpond.net.au @comcast.net @bellsouth.net @pacific.net.sg
1          0.02%  @kw smtp username and password
1          0.02%  @lindenberg.ae
1          0.02%  @live.com.mx @yahoo.com @gmail.com txt2013
1          0.02%  @mail @list @inbox @bk
1          0.02%  @mail.ru @yandex.ru @gmail
1          0.02%  @mailkz pornuxa besplatni vidio
1          0.02%  @maill @comcast @hotmail @gmail @yahoo
1          0.02%  @mendes.co.kr
1          0.02%  @milan.oilfield.slb.com
1          0.02%  @onquest-inc.com
1          0.02%  @outlook.com @hotmail.com @gmail.com @yahoo.com @aol.com @hotmail.com.sa
1          0.02%  @ovi.com william
1          0.02%  @qq.com @yahoo.com @hotmail.com @yahoo.cn 2013
1          0.02%  @radif mail .com
1          0.02%  @telkomsa.net/@mweb.co.za @absamail.co.za securitydoors
1          0.02%  @tiscali.co.uk steel pipe importer/buyer
1          0.02%  @uic.ca
1          0.02%  @uol @bol @zipmail
1          0.02%  @usa sax free download
1          0.02%  @wannado.fr silicone cake mould
1          0.02%  @web.ch... @hotmail.ch... @yahoo.ch... @gmail.com
1          0.02%  @webmail.co.za titanium dioxide
1          0.02%  @wmc.co.kr
1          0.02%  @yahoo @gamail
1          0.02%  @yahoo @live @skype @qq @msn john
1          0.02%  @yahoo companies in germany
1          0.02%  @yahoo email directory of heavy engine spare parts china
1          0.02%  @yahoo email directory of heavy engine suppliers china
1          0.02%  @yahoo oil supplier emails
1          0.02%  @yahoo.ca @yahoo.com txt 2013
1          0.02%  @yahoo.ca xls 2013
1          0.02%  @yahoo.com @gmail.com @hotmail.com @live.com txt @live.com pastors
1          0.02%  @yahoo.com @gmail.com @hotmail.com @qq.com @126.com 2013 passwords txt
1          0.02%  @yahoo.com @gmail.com @hotmail.com txt
1          0.02%  @yahoo.com @hotmail.com @ shaw.ca 2013 email csv
1          0.02%  @yahoo.com @hotmail.com @aol.com @gmail.com @comcast.net @juno.com -scam - -fraud -
1          0.02%  @yahoo.com @hotmail.com @aol.com @gmail.com guest or book india
1          0.02%  @yahoo.com @hotmail.com @gmail.com asia and middle east contractors
1          0.02%  @yahoo.com @hotmail.com @web.de @gmail.com
1          0.02%  @yahoo.com @yahoo.au @yahoo.nz @att.net ext.txt
1          0.02%  @yahoo.com @yahoo.co.uk @ymail.com @yahoo.ca @rocketmail.com bussiness associates -spam -scam -419 -phising
1          0.02%  @yahoo.com txt 2013
1          0.02%  @yahoo.com.my txt 2013
1          0.02%  @yahoo.com.sa@eim.ae@emirate.net.ae@gmail.com@aol.com
1          0.02%  @yahoo.com.tw @hotmail.com.tw xls
1          0.02%  @yahoo.com.ua@hotmail.com@aol.com.net
1          0.02%  @yahoo.com.vn @earthlink.net @juno.com @aol.com @gmail.com
1          0.02%  @yahoo.com@gmail.com@hotmail.com@163.com2013 business emails
1          0.02%  @yahoo.com@gmail.com@hotmail.com@mail.com txt
1          0.02%  @yahoo.es @163.com @rocketmail.com @hotmail.com.br
1          0.02%  @yahoo.in list of textiles companies in india 2013 email .com contact
1          0.02%  @yahoo@gmail.com furniture
1          0.02%  @yandex @mail @gmail
1          0.02%  @yandex @rambler @gmail @mail
1          0.02%  @yandex @rambler @hotmail @gmail @mail
1          0.02%  @yaoo lucano santos.com.br
1          0.02%  @ymail.comrocketmail.comhotmail.comlive.com of ghana scam list in 2013
1          0.02%  \
1          0.02%  \\in-fi101\users1\d\christine
1          0.02%  _)(*
1          0.02%  _52 @yahoo.com @live.com @aol.com @cs.net -
1          0.02%  ___alexey@yahoo.ru @hotmail.com txt
1          0.02%  ___nadya@yahoo.ru @hotmail.com txt 2013
1          0.02%  _hong kong business emails @aol.com @yahoo com@hotmail @gmil .com txt
1          0.02%  a @sbcglobal.net @bellnet.ca @sympatico.ca -
1          0.02%  a to z email directory @hotmail.com
1          0.02%  a_ebrahem62@yahoo.com
1          0.02%  aadi @yahoo.com.au @yahoo.com.au @gmx.de @yahoo.com.br @aol.com @yahoo.com.ca
1          0.02%  aaron eward@aol @comcast @hotmail @gmail @yahoo 2013
1          0.02%  ab @yahoo sbcglobal net comcast net verizon net @gmail com surgeons and doctors guessbook 2012 in california
1          0.02%  aban 210 @g mail.com
1          0.02%  aban@%$@%@$$@%@$cvs@%$%@$$@%@yahoo.com@hotmail.com@bellsouth.net@comcast.net txt
1          0.02%  abbott @yahoo sbcglobal @gmail @hotmail txt
1          0.02%  abbsi only 4u @gmial
1          0.02%  abdalla @ hotmail.com outlook.com jordan traders
1          0.02%  abdallah@yahoo.com@hotmail.com@gmail.com
1          0.02%  abdelaziz @yahoo.com@gmail.com @hotmail.com@rediffmail.com
1          0.02%  abdu1.wen.ru/arh
1          0.02%  abdul @maktoob.com txt @sify
1          0.02%  abdul @maktoob.com txt @sify.com xls @arabia.com csv -
1          0.02%  abdul @yahoo.com @hotmail.com txt
1          0.02%  abdul khalid gmail@
1          0.02%  abdul nasser 2013/2014 @yahoo.com@gmail.com@hotmail.com@aol.com
1          0.02%  abdul---@yahoo.com.pk----@hotmail.com.in-----@sbcglobal.net-----@yahoo.lb-----txt 2013
1          0.02%  abdulahi @yahoo.com @gmail.com @hotmail.com @live.com @aol.com @comcast.com 2012
1          0.02%  abdur email contact rediffmail.com@gmail.com@yahoo.com@hotmail.com@2013
1          0.02%  abdurhman sodas picther
1          0.02%  abertay bd.3gp
1          0.02%  abigail@aol.com@freemail.hu@hotmail@yahoo.com@gmail.com@mail.ru@c2.net
1          0.02%  abo omar 971@hot mail-com
1          0.02%  about arif hossain in setsco
1          0.02%  abraham @yahoo.com @gmail.com @hotmail.com
1          0.02%  abraham haji 65@ yahoo.com
1          0.02%  abreas2013 or guesbook @yahoo.com @hotmail.com @gmail.com -scam/spam
1          0.02%  abu@aol.com@hotmail.com@gmail.com@yahoo.com
1          0.02%  abulhossain@63gmail.com
1          0.02%  account officer real estate agents manufacturers truck dealers oil 2012 2013 @yahoo.com @btinternet.com @hotmail.com @globalsbc
1          0.02%  account officer real estate agents manufacturers truck dealers oil @yahoo.com @btinternet.com @hotmail.com @globalsbc.com
1          0.02%  aci articular cartilage repair procedures
1          0.02%  aci@anet.net.th 2013
1          0.02%  adalbert@yahoo.comadelajda.woods@mail.ru email guestbook 2014
1          0.02%  adam@yahoo.com@aol.com@hotmail.com txt
1          0.02%  adam_mo7amed44@yahoo.com
1          0.02%  adamwwdokon cma
1          0.02%  adding synchrotron radiation to infrared microspectroscopy: what's new in biomedical applications pdf
1          0.02%  address 1address 2citycontactcountrycodeemail @aol.com @gmail.com@hotmail.com@yahoo.com@msn.com 2013 usa txt
1          0.02%  address@hotmail.com @aol.com @yahoo.com txt
1          0.02%  adhesion hypertrophic chondrocyte
1          0.02%  adhesive tape buyer @sinos.net
1          0.02%  adhesive tape importer @emirates net ae
1          0.02%  adhesive tape importer@amet.com.ar
1          0.02%  adiel @mail.de
1          0.02%  adil 119 @gmil . com
1          0.02%  adipose derived stem cell articular cartilage regeneration
1          0.02%  adipose stem cell isolation with sepax system
1          0.02%  adipose stem cell nucleus pulposus
1          0.02%  adipose tissue-derived mesenchymal stem cells: isolation expansion and characterization
1          0.02%  adrian paul @yahoo.co.jp @126.com @yahoo.com.mx @yahoo.com
1          0.02%  advantage of coculture
1          0.02%  adyma2009@yahoo.com
1          0.02%  afghanistan mens looking for marriage guestbook@yahoo.com @gmail.com @hotmail.com 2013
1          0.02%  agco corporation in texas aol email directory 2013 @aol.com @ hotmail.com @ yahoo.com
1          0.02%  agents/distributors @yahoo-wines.de
1          0.02%  aggrecan from bovine articular cartilage purity from sigma aldrich
1          0.02%  agricultural research scientist @yahoo.ca @sbcglobal.net @hotmail.com @aol.com @msn.com @earthlink.net 2012/2013
1          0.02%  agus @hotmail.com @gmail @yahoo.com
1          0.02%  ahmed @hotmail.com txt
1          0.02%  ahmed @yahoo.com@hotmail.com@gmail.comx
1          0.02%  ahmed hamza@hotmail.com 2013
1          0.02%  ahmed hesain 66@ gmail
1          0.02%  ahmed nasiru 61@ yahoo.com
1          0.02%  ahmed2013@yahoo.com.pk txt
1          0.02%  ahmed@aol @comcast @hotmail @gmail @yahoo
1          0.02%  ahmedgamal @hotmail.com 2013
1          0.02%  aiden sophia%40yahoomailgmailhotmailrediffmailmail.com
1          0.02%  aii board directory@hotmail.com@aol.com@gmail.com 2013
1          0.02%  ail 1000@gmail.com
1          0.02%  ailpakstan girls photos download
1          0.02%  aker@netspace.net.au txt 2013
1          0.02%  al rajhi bank gmail.com hotmail.com yahoo.com csv
1          0.02%  al- saleh''@yahoo.com@gmail.com@hotmail.com@aol.com 2013 txt
1          0.02%  al-jaber @gmail.com @aol.com txt 2013
1          0.02%  al-rehman2011%40hotmail.com
1          0.02%  alala-hamed@yahoo.com
1          0.02%  alberto simon @yahoo. com
1          0.02%  alex @yahoo.com @hotmail.com @gmail.com @ymail.com @comcast.net filetype.txt
1          0.02%  alexander @gmail.comm @yahoo.com @hotmail.com 2013
1          0.02%  alexander@hotmail.com 2013
1          0.02%  alexandra@gmail.com@aol.com
1          0.02%  alginate ceramic pdf
1          0.02%  alhamd@cyber.net.pk xls 2013
1          0.02%  ali @gmail.com @yahoo.com hotmail.com @sbcglobal.net comcast.net txt
1          0.02%  ali @hotmail.com @yahoo.com @gmail.com txt i need a loan 2013
1          0.02%  ali @yahoo.com @rocketmail.com @gmail.com txt 2013
1          0.02%  ali@hotmail.com 2013
1          0.02%  aliasingh@gmail.com @yahoo.com @yamil.com @rediffmail.com @hotmail.com @live.com @rocketmail.com
1          0.02%  alibaba business emails of fabric 2013 @yahoo.com@126.com@163.com
1          0.02%  alibaba emails of suppliers of fabrics @126.com@163.com
1          0.02%  alibaba emailshotmailyahoomailoutlook
1          0.02%  aligned fibers electrospinning characteristic
1          0.02%  alisson silva. as 27@gmilacom
1          0.02%  alizarin red s destain protocol
1          0.02%  all business man contact in korean@ yahoohotmail 2013
1          0.02%  all business@yahoo.com belgium
1          0.02%  all buyer email in italian @yahoohotmailgmailaol.
1          0.02%  all current ministers @hotmail.com.ug @yahoo .com@ymail.com.ug
1          0.02%  all over the world email contact and exstablishment... @gmail.com
1          0.02%  allen @yahoo.cayahoo.com 2012 usa australia only
1          0.02%  allie_ @hotmail
1          0.02%  allinurl phproxy/index.php
1          0.02%  alluminium dealers @yahoo.com.@yahoo.cn@hotmail.com 2012
1          0.02%  alluminium tubes @yahoo.com @hotmail.com @gmail.com
1          0.02%  alluminiun supplies in china @gmail.com@hotmail.cn@yahoo.cn@yahoo.com@live.cn
1          0.02%  allumuniun supplies in china@live.cn@hotmail.com@gmail.cn@yahoo.cn
1          0.02%  alphabetical private company directors@hotmail.com
1          0.02%  aluminium manufacturers in asia@yahoo.com@hotmail.com@gmail.com@4share.com
1          0.02%  aluminum extruded products companies owners email addresses 2013@aol.com file type xls
1          0.02%  alumni administration emails @yahoo.com @ymail.com @gmail.com @comcast.net @aol.com @att.net 2011/2013
1          0.02%  alwaheed general trading company@
1          0.02%  amanda @outlook.com @yahoomail.com @google.com @gmail.com 2013
1          0.02%  amanda@yahoo.com@hotmail.com@aol.com@gmail.com txt
1          0.02%  american army @yahoo.com@gmail.com @hotmail.com @aol.com @comcast.net 2013
1          0.02%  american association of exporters and importers 2013@yahoo.com@gmail.com
1          0.02%  american pen pal names emails @yahoo gmail.com virgilio.it
1          0.02%  amirgeece 42 @ songe hd yahoo.com
1          0.02%  amirgeece42@yahoo.com
1          0.02%  ammad @msn.com @mail.ru @ymail.com @mail.com @yahoo.com @gmail.c-
1          0.02%  ammar ceo 45 year o;d to 80 men 2011 2012 2013 gamil.com or or yahoo.com hotmail.com
1          0.02%  ana.abramovic@gmail.com
1          0.02%  ana_robert2011@hotmail.com
1          0.02%  anan@gmail.com @yahoo.com @gmail.com jp xls
1          0.02%  anas aziz 2011 @hotmail.
1          0.02%  anderson 65@yahoo.com 44@hotmail.com 10001@gmail.com 66 @aol.com
1          0.02%  anderson@126.com @163.com @yandex.com @qq.com @yahoo.cn.txt
1          0.02%  andre.dawson@sbcglobal.net
1          0.02%  andrew@yahoo.ca@hotmail.ca@att.net@shaw.ca txt 2013
1          0.02%  andrews@yahoo.com@gmail.com@hotmail.com@aol.com@msn.com 2013
1          0.02%  andy@british virgin island@yahoogmailhotmailaol.com ''txt''
1          0.02%  aneta@yahoo.com@hotmail.com@gmail .com txt 2013
1          0.02%  angel @hotmail.com @yahoo.com @sbcglobal.net @comcast.net 2013 txt
1          0.02%  angel sebastián @hotmail.com 123@
1          0.02%  angelicacurtis@yahoo.com / my porno
1          0.02%  angelinia @yahoo.com @aol.com @hotmail.com @cox.net @msn.com @comcast.net.txt
1          0.02%  angiogenesis large vessel 10µm
1          0.02%  animal model in bone study
1          0.02%  animal models for implant biomaterial research in bone a review
1          0.02%  animal models for implant biomaterial research in bone: a review [j]. european cells and materials,2007
1          0.02%  animal models for implant biomaterial research in bone: a review.
1          0.02%  animal models in dental research
1          0.02%  animal models in research
1          0.02%  animal test implantation
1          0.02%  animal waste bone
1          0.02%  anjolie brasil@
1          0.02%  ann @yahoo.com @hotmail.com 2012
1          0.02%  ann gmail.com@yahoo.co.uk@yahoo.co.cn@yahoo.co.dkyahoo.comyahoo.fr@aol.commsn.comatt.com@hotma.com@comcast.com
1          0.02%  anne @gmail.com @hotmail.com @yahoo.com mexico 2013 txt
1          0.02%  anthonia @yahoo.com @gmail.com @hotmail.com 2013txt
1          0.02%  anthony @yahoo.com.hotmail.com yahoo com hotmail com
1          0.02%  aol@com email only @us
1          0.02%  aom jam-2010 @ hatmail com
1          0.02%  apatech actifuse first sale
1          0.02%  apparatus bovine pericardium fix
1          0.02%  application
1          0.02%  application of carbon nanotube as nanocarrier in medicine pdf
1          0.02%  application of carbon nanotubes with pictures in pdf
1          0.02%  arab association-of-central-qatar jordan india@gmail.comhotmailyahoomail
1          0.02%  arab business men email directory @gmail.com 2012-2013
1          0.02%  arab business men@yahoo@aol@comcast@uae@gmail@sbc@msn@earthlink
1          0.02%  arab email lists @maktoob.com @gmail.com @yahoo.com @hotmail.com @live.com
1          0.02%  arab suppression list txt 2013
1          0.02%  arab.sex.fuck.feger.age35
1          0.02%  arabian trading agency@yahoo.com @gmail.com @163.com sales@ xls
1          0.02%  arabic country emails @yahoo.com@hotmail.com@ymail.com@gmail.com 2012
1          0.02%  arabic dictionary @yahoo..@gmail
1          0.02%  arabic name emails@yahoo.com@gmail.com@hotmail.com@mail.ru@yandex.com2013
1          0.02%  arabic/pakistan emails@yahoo.com@gmail.com@hotmail.com@ymail.com2012
1          0.02%  arabyk sexfree
1          0.02%  aragonjennifer44@yahoo.com
1          0.02%  arbab new sex fauking video 3gp 2013 xnxx com
1          0.02%  aribe porantube
1          0.02%  arnaud @rogers.com @bell.ca @sympatico.ca 2013 .txt
1          0.02%  arnold % @yahoo.com @aol.com @gmail.com @hotmail.com 2013 usa address txt
1          0.02%  arrangement collagen structure pdf
1          0.02%  artavisbot
1          0.02%  articular cartilage regeneration using periosteum
1          0.02%  artificial heart bovine
1          0.02%  artificial heart market research
1          0.02%  arunkumar.facebook9.com
1          0.02%  asia emails@yahoo@gmail@hotmail.com@earthlink@verizon@aol
1          0.02%  asian and europe meeting gmail.com @yahoo.com @hotmail.com
1          0.02%  asian parts suppliers worldwide@gmail.com
1          0.02%  asian suppliers industrial machines @yahoo @hotmail 2013
1          0.02%  asian suppliers of industrial machines @yahoo @hotmail
1          0.02%  asian traders guestbook@yahoo.com@msn.com@aol.com
1          0.02%  asians emails @yahoo @gmail @hotmail @aol
1          0.02%  aslam hassan@aol.comgmail.comyahoo.comcomcast.nethotmail.com
1          0.02%  association of contractors dealers in isreal aol email directory 2013 @aol.com
1          0.02%  association of eygptians chemical exporters registered email database for 2012/13 on karim@yahoo.inkarim@gmail.comkarim@rediffm
1          0.02%  association of medical doctors @yahoo.com @gmail.com @aol.com
1          0.02%  atdc5 brasil
1          0.02%  atdc5 in brazil
1          0.02%  au$toslrp
1          0.02%  aubi@aol.com@sbcglobal.net@hotmail.com@yahoo.ca@yahoo.com 2013 txt
1          0.02%  audu@gmail.com@yahoo.comcomcast.net@aol.com
1          0.02%  auguster williams@yahoo.de 2012
1          0.02%  aui @yahoo.com@hotmail.com@yahoo.com.cn@gmail.com@cox.net 2013
1          0.02%  austin@yahoo.com @hotmail.com @gmail.com xls
1          0.02%  australia@yahoo.com@gmail.com@hotmail.com@aol.com.hong kong 2013
1          0.02%  australian 2013 farmers association and business enterprises @yahoo @gmail @aol @hotmail
1          0.02%  australian fresh seafood exporters @sify@gmail
1          0.02%  austria @gmail.com @hotmail.com @yahoo.com txt
1          0.02%  austria members directories @msn.com txt
1          0.02%  austria tyre importers @hotmail
1          0.02%  austrilia@optusnet.com.auowners@tpg.com.aujoe@yahoo.com txt
1          0.02%  austrolian xxx vedio
1          0.02%  auto car dealers @yahoo.com @gmail.com @aol.com china txt
1          0.02%  auto dealers shipping email @rediffmail.com @gmail.com
1          0.02%  auto parts exporter @163.com on yahoo.com
1          0.02%  auto parts importers and exporters@yahoo.com or @gmail.com or @hotmail.com
1          0.02%  avn manufacturing company directory@yahoo@hotmail@gmail.com 2013
1          0.02%  ayesha seeking for directors email@hotmail.com'' 2013
1          0.02%  azin@yahoo.com@gmail.com@hotmail.com@comcast.net 2013
1          0.02%  b mr a 345 @email 2013
1          0.02%  b%c3%b6rsenmakler%40bluewin.ch%40gmx.ch%40swissonline.ch%40freesurh.ch%40aol.com 2013
1          0.02%  b2b leads @sina.com @yahoo.cn @162.com @126.com
1          0.02%  bagdad1@bluewin.ch
1          0.02%  baghdad khalid@gmai.com.iq
1          0.02%  bagladad @sex
1          0.02%  bahrain and india workshop @batelco.com.bh @emirates.net.ae sify.com
1          0.02%  balance between anabolism and catabolism and human health
1          0.02%  baling 30 @yahoo com 123456789 santos
1          0.02%  ball valve importers
1          0.02%  ballack @gmx.de @yahoo.de @web.de @hotmail.de @edu.de
1          0.02%  bamboo dealers in japan @hotmail.com @net.jp @yahoo.jp @hotmail.jp
1          0.02%  bangladesh islami cttara senha facebook
1          0.02%  bangladeshi dhaka darus salam pornwap
1          0.02%  bankers 2013 yahoomail /gmail.com
1          0.02%  banking @yahoo .com slovakia
1          0.02%  barbara
1          0.02%  barbara @yahoo.de @freenet.de @web.de @arcor.de- scam email-webmaster email 2013
1          0.02%  barbara@yahoo.com@gmail.com@hotmail.com@aol.com
1          0.02%  barbed wire @cyber.net.pk
1          0.02%  barbed wire @pacific.net.sg
1          0.02%  barbra australia @yahoo.com .au @hotmail.com.au @gmail com.au
1          0.02%  basic reactions of osteoblasts on structured material surfaces
1          0.02%  bathroom accessories buyer@
1          0.02%  battery importers @hotmail.@yahoo.com@gmail.com@126.com
1          0.02%  battery manufacturers and dealers email list in south korea 2013@yahoo.com.sg@gmail.com
1          0.02%  bb@yahoo.com@aol.com@hotmail.com@gmail.com@mail.ru 2012/2013
1          0.02%  bbwsex fiams.oman
1          0.02%  bearing importer in middle east
1          0.02%  behaviour of moderately differentiated osteoblast-like cells cultured in contact with bioactive glasses
1          0.02%  belgium supplies 2013@gmail.com@hotmail.com@yahoo.com.
1          0.02%  benefits of using concentrated stem cells for non unions
1          0.02%  benin goods importer
1          0.02%  benoreya datkam
1          0.02%  benson @2013 @yahoo.com @aol.com @hotmail.com .txt
1          0.02%  benson ymail.gmailyahoomailhotmail @ 55..111
1          0.02%  bentley @yahoo.com @gmail.com @aol.com @webmail.com txt
1          0.02%  bernard.kim@aol.com
1          0.02%  beta bsm cement user guide
1          0.02%  beta.mohameed 77 @hot mail.com
1          0.02%  bicycle and toy manufacturer @163.com @126.com txt
1          0.02%  big tube xxx video 61@ 2012
1          0.02%  bill @yahoo.com @aol.com @gmail.com @hotmail.com 2013
1          0.02%  bill@gmail.com@aol.com@hotmail.com@yahoo.com
1          0.02%  bill@yahoo.com/hotmail.com/gmail.com
1          0.02%  bill@yahoo.com@012.net.il @aol.com@mail.ru@gmail.com txt
1          0.02%  billy@gmail.com@hotmail.com@aol.com@msn.com@yahoo.com spain
1          0.02%  bin@yahoo.com@ymail.com@gmail.com@rediffmail.com@hotmail.com@net.com
1          0.02%  biodegradable metals 2013 umang island
1          0.02%  biological and medical applications of carbon nanotubes
1          0.02%  biological application of carbon nanotubes
1          0.02%  biology and biomechanics in fracture management
1          0.02%  biomaterials and veterinary surgical implants
1          0.02%  biomechanics of fracture fixation chao eys. 1997
1          0.02%  biophysical simulation of bone pdf
1          0.02%  biophysical stimulation of bone fracture repair regeneration and remodeling
1          0.02%  birlafinance 64 @gmail com.
1          0.02%  bishop @yahoomail@ymail@rocketmail
1          0.02%  biz@hotmail.com@yahoo.com 2013 world traders
1          0.02%  bk ool @aol com @orange fr 33
1          0.02%  blessingjames109
1          0.02%  blowupdate@yahoo.com
1          0.02%  board member lee@yahoo.tw@msn.com@hotmail.com
1          0.02%  board of directors @yahoo.com.my @@hotmail.com.my txt 2011
1          0.02%  bohner silicated hydroxyapatite
1          0.02%  bolivia and usa @yahoo.com@hotmail.com.bo @aol.com@msn.com@live 2013
1          0.02%  bone and glutamate
1          0.02%  bone cement qualitative statistics study
1          0.02%  bone cement/fill putty
1          0.02%  bone fracture healing
1          0.02%  bone fracture journal pdf
1          0.02%  bone fracture repair
1          0.02%  bone fractures research paper
1          0.02%  bone graft susbstitute versus bone cement
1          0.02%  bone lenthening osteotomy
1          0.02%  bone loss for absence of mechanical stimuli
1          0.02%  bone model in sheep hip
1          0.02%  bone regeneration machine
1          0.02%  bone repair and different location in rabbit femur head
1          0.02%  bovine pericardium patch
1          0.02%  bownloab uc drowser v 8.6.0.318
1          0.02%  brazil @yahoo@hotmail@gmail@ymail 2013
1          0.02%  brazzerx fut bolxxx
1          0.02%  brianhoward16@ya.ca
1          0.02%  brightlight موقع abdu1 تحميل برنامج
1          0.02%  brokers in spain pdf *@gmail
1          0.02%  brown 60 @yahoo.com @yahoo.ca @hotmail.com @att.net @earthlink.net @comcast.net 2013
1          0.02%  brown @gmail.com @yahoo.com @hotmail.com @comcast .net @aol.net txt 2013
1          0.02%  brunswick@web.de
1          0.02%  bryan @yahoo.com @hotmail.com @aol.com @txt
1          0.02%  builder @hotmail.com @gmail.com @aol.com @mail.ru united state
1          0.02%  building materials dealers in china @yahoo.com @hotmail.com @gmail.com
1          0.02%  bulldozer manufacturerssuppliersexporters @126.com @hotmail.com @yeah.net @163.com
1          0.02%  business abdel @hotmail -scam419
1          0.02%  business activities in irelands cities @yahoo.ie @vodafone.ie @hotmail.ie
1          0.02%  business email leads @live.com @hotmail.com @126.com @263.com @yeah.com @qq.com
1          0.02%  business emails gmail.com@hotmail.com@aol.comtxt
1          0.02%  business man in iran@yahoo.com@gmail.com@hotmail.com@aol.com@msn.com
1          0.02%  business men @qq.com @163.com @yahoo.com.cn @126.com @gmail.com
1          0.02%  business men in india @yahoo@gmail@hotmail.com
1          0.02%  business men in jordan seeking for investors @yahoo @gmail @hotmail @live
1          0.02%  business owners in florida @yahoo.com @hotmail.com @gmail.com
1          0.02%  business owners yahoo.de yahoo com aol.com filetype: xls
1          0.02%  business traders yahoo cn yahoo com hk yahoo fi yahoo es yahoo se yahoo br yahoo co uk yahoo ie filetype xls
1          0.02%  business@yahoo.com hungary
1          0.02%  businessman @gmail.com or yahoo.com or aol.com
1          0.02%  businessmen and women in brunei@yahoo.com@hotmail.com@comcast.com@gmail.com@aol.com@btinternet.com@msn.com
1          0.02%  businessmen in saudi arabia@yahoo gmail hotmail aol.com
1          0.02%  bussines email company in italy @yahoo.it @hotmail.it .2012.txt
1          0.02%  bussiness owner at yahoo.com yahoo.ca aol.com gmail.com comcast.com hotmail.com live.com at juno.com email contact
1          0.02%  buy stainless steel welding wire intitle:welding wire email
1          0.02%  buyers and manufacturers of gold accessories @yahoo.com.au@hotmail.com.pk
1          0.02%  buyers and manufactures of china tyres @yahoo.cn@gmail.com@hotmail.com@126
1          0.02%  buyers and manufactures of china tyres@yahoo.cn@gmail.com@hotmail.com@126
1          0.02%  buyers and sellers of crude oil @yahoo.com.au@hotmail.com.ru
1          0.02%  buyers and sellers of paper in asia @yahoo.com @gmail.com @hot mail.com
1          0.02%  buyers and sellers of rice in china @yahoo.com@gmail.com txt
1          0.02%  buyers of eletronics @hotmail.com @gmail.com 4share.com
1          0.02%  buyers/sellers raw materials @hotmail.com163.comyahoo.com.cngmail.com txt 2012
1          0.02%  bárbara@yahoo.pe dirección@hotmail.pe in portugal in 2013
1          0.02%  börse bz doris078
1          0.02%  c yahoom xtx
1          0.02%  calcification bovine pericardial patch
1          0.02%  callos phosphate injectable synthetic graft
1          0.02%  calstrux cement
1          0.02%  cambodia import/export meat and chicken @yahoo.com @ymail.com
1          0.02%  cameras .co ltd@163.com @126.com
1          0.02%  can the iliac crest be damaged as a result of an injury to lumbar disc degeneration
1          0.02%  canada @gmail @yahoo @outlook
1          0.02%  canada rose @yahoo.ca @aol.com @hotmail.com @att.combr 2013
1          0.02%  canadan @yahoo.com@hotmail.com@aol.com@sbglobal.net@gmail.com@att.net txt/2013
1          0.02%  canadia business men @yahoo.com @hotmail.com @aol.com @msn.com @tt.com @gmail.com
1          0.02%  canadian law firm @aol.com @hotmail.com @shaw.com xls
1          0.02%  cancellous bone model sheep
1          0.02%  candy@yahoo.com@hotmail.comtxt
1          0.02%  car body repairs xlsmail@*.com.au
1          0.02%  car dealers in saudi arabia aol
1          0.02%  car parts supplier in china @hotmail.com @live.com @msn.com
1          0.02%  carbon applied in medicine
1          0.02%  carbon fiber mesh for medical use
1          0.02%  carbon nanotubes applications in medicine
1          0.02%  carbon nanotubes for medical applications
1          0.02%  carbon nanotubes in healthcare
1          0.02%  carbon nanotubes medical
1          0.02%  carbon steel pipe .indonesia. email
1          0.02%  carbon-fiber peek wear biocompatibility jaw bone
1          0.02%  carlo silva @att .net
1          0.02%  carlos @yahoo.com @gmail.com @hotmail.com 2013 txt pdf file
1          0.02%  carlos@yahoo.com@gmail.com@hotmail.com@att.net txt txt txt txt leads 2013
1          0.02%  carol 74 @yahoo.cs @hotmail.com @gamil.com @msn.com @att.net @comcast.net 2013
1          0.02%  carol @yahoo.com @hotmail.com @gmail.com @aol.com 2013
1          0.02%  carol-al@gmx.de
1          0.02%  carpets suppliers@yahoo.hk xls
1          0.02%  cartiladge disc ecm tissue
1          0.02%  cartilage defects repair stategies
1          0.02%  carton machine buyers @email .com
1          0.02%  carton machine buyers @indiatimes .com
1          0.02%  carton machine buyers@ wilnetonline.net
1          0.02%  cast cobalt chrome properties
1          0.02%  castings buyer@westnet.com.au
1          0.02%  catcttctcaaaattcgagtgacaa
1          0.02%  cctv camera buyer mail@
1          0.02%  cctv camera com.qa
1          0.02%  cctv cameras @cytanet.com.cy
1          0.02%  cctv cameras @nesma.net.sa
1          0.02%  cctv cameras @ttnet.net.tr
1          0.02%  cctv@rawagegypt.com
1          0.02%  cell biomaterial interface review
1          0.02%  cell co-culture system
1          0.02%  cell coculture system
1          0.02%  cell elongation imagej fibroblast
1          0.02%  cell mater journal
1          0.02%  cell material journal
1          0.02%  cells and materials
1          0.02%  cells materials journal
1          0.02%  cement manufacturers @gmail.com @yahoo.com @hotmail.com @126.com @aol.com @mail.com @163.com
1          0.02%  ceo @yahoo @gmail @hotmail .txt .xls
1          0.02%  ceo of all companies in nigeria @yahoo.com @hotmail.com @gmail.com
1          0.02%  ceo of companies@yahoo.ca@yahoo.com.au@yahoo.fr@hotmail.com@yahoo.co.uk@ aol.com@gmail.com@sbcglobal.net 2013
1          0.02%  ceo@hotmail.com@rocketmail.com@live.com@msn.com@yahoo.com@ymail.com@aol.com@gmail.com@at
1          0.02%  cerakat megs live afg v neb
1          0.02%  cerament radio pacifier
1          0.02%  ceramic cement formulas
1          0.02%  ceramic tiles manufacturing and trading company in china @yahoo.com @163.com @126.com @yeahnet.com @hotmail.com @qq.com
1          0.02%  ceramics plastics and tiles industries in china @yahoo@gmail.com
1          0.02%  cervical disc herniation marker pdf
1          0.02%  chambers of commerce and industry in iran @hotmail.com @gmail.com @yahoo.com @aol.com
1          0.02%  characterization of stem cells
1          0.02%  characterization of stem cells pdf
1          0.02%  charlie@comcast.com @yahoo.fr @live.com @mail.com txt 2013
1          0.02%  chemical @yahoo.com.@chinamail.com hotmail.com
1          0.02%  chemical dealers in america @yahoo.com @hotmail.com @gmail.com
1          0.02%  chemical importersexportersmanufacturerdealers in hong kong china@hotmailyahoogmail.com
1          0.02%  chemical manufacturers in china lee@yahoo@ymail@hotmail@gm
1          0.02%  chevy chevy ly ve mp3 bistriy poisk
1          0.02%  chicken farm @omantel.net.om
1          0.02%  chief editor 2013@bol.com.br@uol.com.br@inbox.com@terra.com@hotmail.com
1          0.02%  chief executive directors of companies in asia uae europe @yahoo.com @aol.com @gmail.com 2013 txt
1          0.02%  chiemgau24 @ web.de @yahoo.de @freenet.de @aol.com @aon.de @online.de @t-online.de @gmx.de 2 013
1          0.02%  china 163.com .txt
1          0.02%  china 2013 copper suppliers @163.com @126.com @yahoo.cn @yahoo.com xls 86
1          0.02%  china air conditioner manufacturer email @yahoo.com filetype:pdf or filetype:doc orfiletype:xls
1          0.02%  china and hong kong traders email address@yahoo.com@homail.com
1          0.02%  china bags companies database @yahoo. cn@qq.com@163.comlive.cn
1          0.02%  china crude oil importers and exporters email listing @gmail.com@yahoo.com@126.com@163.comlive.com@hotmail.com
1          0.02%  china drugs manufacturer @gmail @hotmail @live @yahoo
1          0.02%  china electrical equipments suppliers manufactures and dealers @yahoo.com @yahoo.cn @gmail.com @qq.com @hotmail.com
1          0.02%  china electronics exporters@yahoo.com china.com mail.com2013 update
1          0.02%  china export and importers companies of textiles @yahoo.cn@hanmail.net @rediffmail.com
1          0.02%  china importer exporter machine parts @yahoo.com@gmail.com@hotmail.com@live.com
1          0.02%  china importers exporters general merchandise @hotmail @gmail @yahoo @aol @live
1          0.02%  china ltd drug @163.com@yahoo.com@gmail.com
1          0.02%  china manufacturers of doors @yahoo.cn hotmail com 126 com gmail com 163 com
1          0.02%  china manufacturing companies @126.com or @qq.com or @yahoo.com.my or @yahoo.com.cn -spam
1          0.02%  china raw materials importers-exporters 2012 @163.com @yahoo.cn @sina.com
1          0.02%  china suppliers
1          0.02%  china suppliers @yahoo.com @gmail.com @hotmail.com @live.com @126.com @163.com @mail.com @webmail.com
1          0.02%  china.majed.coom
1          0.02%  chinamanufacturingcompanies@yahoo.cn
1          0.02%  chinese sales email data base yahoo hotmail 163.com vip.163.com vip.qq.com 126.com txt
1          0.02%  ching @yahoo.com @hotmail.com @aol.com @hotmail.com txt... 2013
1          0.02%  chitosan coating in fruit pdf
1          0.02%  chitosan in fruit pdf
1          0.02%  chondrogenic differentiation ecm deposition
1          0.02%  chris@gmail.com@yahoo.com@hotmail.com@ymail.com text
1          0.02%  christian@web.de@gmail.com@yahoo.com@aol.com 2013 text
1          0.02%  christiana @ yahoo com @gmail com @comcast com @hotmail com 2012 13
1          0.02%  christopher@yahoo.com txt csv
1          0.02%  chrome oxide buyer @
1          0.02%  chrome oxide importer @
1          0.02%  chung@gmail.com@yahoo.com.hk@hotmail.com.txt
1          0.02%  chung@yahoo.com.cn @gmail.com @hotmail.com txt
1          0.02%  chunlee@yahoomail@gmailoutlook.com
1          0.02%  chuz_rodriquez @outlook .com
1          0.02%  cindy@yahoo.com @hotmail.com @oal.com @men.com @txt
1          0.02%  cindy@yahoo.com@gmail.com@hotmail.com@live.com
1          0.02%  cindyasua@yahoo.in
1          0.02%  claire@allmail.comcaramail.comyahoo.co.de 2013 email link
1          0.02%  clara james@yahoo.com@hotmail.com@aol.com@gmail.comtxt 2012
1          0.02%  classifieds man seeking woman in classifieds facebook.com with email@yahoo.de @gmail.at @hotmail.de @livemail.at
1          0.02%  clement.joseph@comhem.se
1          0.02%  cloth manufacturing companies in china yahoo 4shared gmail hotmail 360 cragislist
1          0.02%  clothing manufacturers and exporters in turkey yahoomail hot mail gmailemaills phone numbers fax
1          0.02%  cn 86 furniture yahoo gmail hotmail txt
1          0.02%  co culture cell cell interaction
1          0.02%  co culture cells
1          0.02%  co culture experiments
1          0.02%  co culture system
1          0.02%  co culture techniques
1          0.02%  co-culture protocol
1          0.02%  co-culture system
1          0.02%  cobalt chrome moly material
1          0.02%  coble@hotmail.com yahoo.com sbcglobal.net aol.com shaw.ca 2013
1          0.02%  coculture
1          0.02%  coculture system
1          0.02%  cohalank@bigpond.com@gmail.com@sbcglobal.net
1          0.02%  collagen nanoparticles carbon elecrtodeposition carbon nanotubes
1          0.02%  comcast.com.........%........csv........txt 2013
1          0.02%  cominbo uma ana sex videos 3gp
1          0.02%  como baixar moodleid no lg t375
1          0.02%  companies directors and c.e.o in the united statess dairy@yahoo.co.uk @hotmail.com.ca @gmail.com.qa @aol.com @rocketmail.com.br
1          0.02%  companies in malaysia txt @yahoo @hotmail @126
1          0.02%  company belgium spare parts @yahoo.com @hotmail.com @aol.de
1          0.02%  company director@yahoo.com.tw@hotmail.com@gmail.com
1          0.02%  company directors @hotmails -2012/13
1          0.02%  company directory in japan and singapore @singnet.com.au @yahoo.jp @optusnet.com.au e-mail fax txt
1          0.02%  company email address in singapore @yahoo @gmail.com @ymail.com @hotmail.com @net @org
1          0.02%  company executive directors @yahoo.com @aol.com @juno.com @hotmail.com 2013 txt
1          0.02%  company managers @hotmail.@yahoo.com@gmail.com@126.com
1          0.02%  company owners 966@yahoo.com @hotmail.com @gmail.com @aol.com 2013
1          0.02%  company owners in asiausaeuropecontracors in asiausaeuropebusiness men in asiausaeurope@yahoo.com@gmail.com@comcast.net@cox.net
1          0.02%  company supplier in chinataiwanmalaysia @163. @126. @yeah.
1          0.02%  company workers(contact)in europe@yahoo.com@hotmail.com
1          0.02%  companyowner in southafrica @yahoo.com @hotmail.com @gmail.com @aol.com
1          0.02%  comparison between bone graft in implantology
1          0.02%  complete list of manufactures dealers in the world 2013 @yahoo.com @hotmail.com @gmail.com @mail.com @aol.com
1          0.02%  comافغان ‏xxx‏ ‏vedeos
1          0.02%  conferences in switzerland 2014
1          0.02%  construction companies in dubai in gmailaolyahoomail.comyandexrediffmail
1          0.02%  construction companies in egypt@aol.comgmail.comyahoo.comhotmail.com
1          0.02%  construction company e-mail 98@gmail.com @hotmail.ir @yahoo.ir 2013
1          0.02%  contact address of car dealers in yahoo gmail hotmail com in asia txt
1          0.02%  contact apoa2012.com
1          0.02%  contact arabiayemen.net
1          0.02%  contact azetcontact.cz
1          0.02%  contact email details of engineers in saudi arabia yahoo.sa
1          0.02%  contact email online community friend angola @ hotmail gmail yahoo.com.mx
1          0.02%  contact email online dating friend singapore @ hotmail gmail yahoo.com.mx
1          0.02%  contact email online friendship profiles @ hotmail gmail yahoo.com.mx
1          0.02%  contact jefferson.edu
1          0.02%  contact kladovonet.com
1          0.02%  contact maxcom.net.mx
1          0.02%  contact minascopy.com.br
1          0.02%  contact of gold miners@yahoo.com@gmail.com@aol.com@earthlink.com2013
1          0.02%  contact sbmu.ac.ir
1          0.02%  contact solvernet.jp
1          0.02%  contacts @gmail.com @aol.com @hotmail.com metal and gold
1          0.02%  contacts of slovakia private companies @yahoo.com @hotmail.com @aol.com @gmail.com
1          0.02%  contractor emails in asia @ gmail@yahoo@hotmail
1          0.02%  contractors directories@comcast.net in usa 2011/2013
1          0.02%  contractors email in europe's@gmail @yahoo @ hotmail
1          0.02%  contrators@yahoo.com@yahoo.in@gmail.com@hotmail.com llc
1          0.02%  cooke@yahoo.com@gmail.com@hotmail.com suppression. txt
1          0.02%  cooper world guestbook 2013 aol ch hotmail vxz
1          0.02%  cooper@yahoo.co.uk cooper@hotmail.com.uk cooper@yahomail.com cooper@gmail.com.fr cooper@aol.com.br
1          0.02%  copper ore mail@ site.:in
1          0.02%  copper scrap contract buyers dubai phone email fax@yahoo.com xls file 2013
1          0.02%  copper wire manufacturers in india rediffmail.com yahoo.co.in
1          0.02%  copy paper @omantel.net.om
1          0.02%  copy paper buyer@yahoo.com
1          0.02%  copy paper importer@hotmail.com
1          0.02%  corp screen manufacturers @163.com @126.com @webmail.com txt
1          0.02%  cost benefit bioprosthetic and mechanical heart valve
1          0.02%  cotton exporters@aol.com@yahoo.com@gmail.com@hotmail.com guest book2013
1          0.02%  crane@yahoo.com@gmail.com@hotmail.com@aol.com 2013 guest book
1          0.02%  crude oil deals brazil @yahoo com @msn com au txt
1          0.02%  crude products company in ukraine @mail.com. ukr %@yahoo.com %@gmail.com . ltd 2013
1          0.02%  cscoe logon.html guest login
1          0.02%  csv@gmail.com@ymail.com@yahoo.see@hotmail.co.uk@yahoo.com
1          0.02%  current concepts in stem cell therapy for articular cartilage repair
1          0.02%  current email contacts farmers owners guestbook@ mexico
1          0.02%  current email lead for george wesley@msn.com @yahoo.com@att.net txt 2012
1          0.02%  current email leads in europe @yahoo.de @hotmail.de @gmail.com
1          0.02%  current management in lumbar degenerative disc disease
1          0.02%  current private company associations @yahoo.com @gmail.com @aol.com @hotmail.com 2013
1          0.02%  current problem in cartilage tissue engineering.pdf
1          0.02%  current update united arab emirates cottonwood supplier companies distributors email list phone@gmail.com
1          0.02%  curtis cell adhesion
1          0.02%  cynthia %40msn.com %40aol.com gmail.com 2013
1          0.02%  cz_my gamer on@yahoo com
1          0.02%  d1 orl uva chondrocyte
1          0.02%  dan @hotmail.com@yahoo.com@myway.com@sbcglobal.net@gmail.com
1          0.02%  dan @yahoo com@aol com@airpost.net@live.com@gmail.com@hotmail.com 2013
1          0.02%  daniel realtors agentsproducersdoctorscarpentersprofessionals using @aol.com@yahoo.com@hotmail.com@live.com@mail.live@comcast.n
1          0.02%  danoel@yahoo.com@hotmail.comtxt
1          0.02%  darlehen 2013 @de
1          0.02%  darlehen dringend heute 2013@hotmail.com
1          0.02%  darlehen wollte 2013 deutschland @de
1          0.02%  dat@arcor.de @yahoo.de@web.de@gmx.de@freenet.de 10 august 2013
1          0.02%  dating profile emails site female seeking for male yahoomail@hoymail online 2013
1          0.02%  dating profile emails site male seeking for ethiopia yahoomail@hoymail online
1          0.02%  dating site for chat society for engineers directors email ethiopia online yahoomail@hotmail
1          0.02%  dave email @yahoo.com txt 2013
1          0.02%  davi d.job 97@ yahoo.com
1          0.02%  david 601@yahoo.com@gmail.com@live.com@aol.com@hotmail.com@city.com txt 2013
1          0.02%  david s email from company in uk email@yahoo.com@gamil.com/ 2013
1          0.02%  david@yahoo.com@hotmail.com@aol.com@sbcglobal.net/2013 txt
1          0.02%  davis @aol.com gmail.com @live.com @ yahoo.es txt
1          0.02%  dealer and supplier of doors in china @yahoo@gmail@hotmail
1          0.02%  dealer and supplier of office
1          0.02%  dealers of mechanical instrument importer and exporter @263.com @188.com @126.com @163.com @qq.com yahoo.cn @hotmail.com.txt
1          0.02%  dean phillips 47@gmai online dating profile
1          0.02%  decorin in bone formation
1          0.02%  degenerative disc disease treatments europe
1          0.02%  degrapol
1          0.02%  density measure in coppe-graphite composite pdf
1          0.02%  dental animal model
1          0.02%  dental bone graft mini pig animal model
1          0.02%  dental medical care distributors @yahoo.fr
1          0.02%  dentists members email directory at gmail.com 2013 california
1          0.02%  describe carbon base implant materials
1          0.02%  desmond@yahoo.com@hotmail.com@gmail.com@aol.com txt
1          0.02%  determining contribution in co-culture system
1          0.02%  deutschland @gmx.de @yahoo.de @gmail.com 2013
1          0.02%  dev %40hotmail.com %40sify.com gmail.com %40aol.net
1          0.02%  dhaka hot six move xvadios
1          0.02%  diamond drilling companies in africa gmail.*@org
1          0.02%  diamond manufacturers sellers company qatar phone fax email@yahoo.com
1          0.02%  diamondgold dealers@hotmail.com@comcast.net@gmail.com
1          0.02%  diana-nedne@yahoo>com@hotmail.com@comcast.net txt
1          0.02%  diaz_de_ leon @hatmail .com
1          0.02%  diesel @live @yahoo @hotmail
1          0.02%  diesel generator@gmail.com
1          0.02%  dir tel fax surveyors email addresses @ao
1          0.02%  director of finance @yahoo email list participants
1          0.02%  director@yahoo.com@sbcglobal.net@aol.commail.com 2012/2013 txt
1          0.02%  directories of textile store wholesales and retailers in california usa @yahoo.com@hotmail.com@gmail.com@aol.com
1          0.02%  directors @yahoo.com @hotmail.com @gmail.com 2012 2013 txt
1          0.02%  directors email in israel filetype: .txt
1          0.02%  directors in germany @hotmail.com@yahoo.com@aol.com
1          0.02%  directors in south korean @yahoo.com gmail.com
1          0.02%  directortrading companies in saudi arabia@yahoo.com@gmail.com@hotmail.com
1          0.02%  directory @gmx.de@hotmail.de@yahoo.de 2012-2013
1          0.02%  directory for chemical supplies in china @yahoo.com gmail.com hotmail.com aol.com .txt
1          0.02%  directory importers exporter supplier of suppliers manufacturers factory tunisia scam police supplier yahoo com till date
1          0.02%  directory of medical directors in asiausa
1          0.02%  directory suppliers for wears in usa @aol.com
1          0.02%  directory women society @gmail.com @hotmail.com @aol.com 2013
1          0.02%  direktori staf @yahoo.com.my@yahoo.com@hotmail.com@yahoo.com.sg 2013
1          0.02%  disadvantage of intravenous mesencymal stem cele
1          0.02%  disc degeneration neck current surgical options
1          0.02%  disc nucleus replacement
1          0.02%  dissection of knee joint pdf
1          0.02%  distributors in united arab emirate @yahoo.com @hotmail.com @gmail.com
1          0.02%  dmp1 gene deciduous teeth stem cells
1          0.02%  dns 1edi.com
1          0.02%  dns 1edi.com 201055
1          0.02%  dns 1edi.com ecmjornal 2010
1          0.02%  dns 1edi.com rechen zentrum doris078
1          0.02%  dns 1edi.com rechen zentrum es doris078
1          0.02%  dns 1edi.com statistiken ecmjornal 2010
1          0.02%  do you need a loan@gmail.com@yahoo.com@hotmail.com
1          0.02%  doctor gmx.ch bluewin.ch aoldatazug.ch 2011 txt
1          0.02%  doctor@yahoo.com slovakia
1          0.02%  doctors @yahoo hungary
1          0.02%  doctors directories in singapore @hotmail.com@gmail.com
1          0.02%  doctors directories in yemen@hotmail.com@gmail.com@yahoo.de
1          0.02%  doctors doctor directory ‎in saudi arabia@hotmail.com @gmail.com @yahoo.com
1          0.02%  doctors middle east @hotmail.com 2013
1          0.02%  doctors@uol.com.br yahoo.com.br hotmail.com.br txt 2013
1          0.02%  doctors@yahoo.com.san marino
1          0.02%  does light weight bearing influence bone repair
1          0.02%  dogxxx.wen.ru.com
1          0.02%  dom gmx.ch bluewin.ch aoldatazug.ch 2010 txt
1          0.02%  don leon recession @yandex. ru
1          0.02%  donald@yahoo.com@aol.com@gmail.com txt
1          0.02%  donde encontrar amniofix injectable en california
1          0.02%  donna@yahoo.com@hotmail.com@gmail.com@aol.com txt
1          0.02%  dorsal skinfold chamber panniculus
1          0.02%  douglas@yahoo.co.uk douglas@hotmail.com.qa douglas@gmail.com.ca douglas@rocketmail.com.hk douglas@aol.com csv
1          0.02%  dowenbrown@hotmail.com
1          0.02%  download whatsapp generic version for samsung gt b7722
1          0.02%  dr 974@gmail.qa @hotmail.qa @yahoo.qa @liveqa @aol.qa
1          0.02%  dr hameed 72@ yahoo.com
1          0.02%  dr in usa 60 @yahoo.com @yahoo.ca @hotmail.com @att.net @earthlink.net @comcast.net 2013
1          0.02%  dr list of participants integrated farming university brasil gmail .edu
1          0.02%  dr phillip @yahoo.co.uk @yahoo.ca @yahoo.com.hk @yahoo.nz @yahoo.com.fr @yahoo.kr @yahoo.au @yahoo.sg @yahoo.mx @yahoo.in @sbcg
1          0.02%  dr. youssef @sbcglobal.net @gmx.de 2013
1          0.02%  dr.moira @yahoo.com 2013 -@aol.com
1          0.02%  dr@yahoo.com @hotmail.com @aol.com @usa.net @yahoo.co.uk/2008/2009
1          0.02%  draver ltv sudiaarb
1          0.02%  drico sr 2013 @hotamil .com
1          0.02%  dringende darlehen in german@hotmail.de @ yahoo.com benötigt
1          0.02%  dringende darlehen needed @gmail.com @ yahoo.com
1          0.02%  drive@cs.net@netscape.net@msn.com@gmail.com@bigpond.com@aol.com
1          0.02%  drsmail@gmx.net
1          0.02%  drug rehab clinics alexandracontact@*.hotmail.com
1          0.02%  dubai automobile importersexporters and dealers @yahoo.com @emirates.ae @gmail.com
1          0.02%  dubai jeweries manufacturers @yahoo.com @hotmail.com @gmail.com @126.com
1          0.02%  dubai seafood suppliers @hotmail yahoo
1          0.02%  dubai traders suppliers of air condition @yahoo.com @yahoo.com.ph @yahoo.com.my
1          0.02%  dubai traders suppliers of sea food @yahoo.com @yahoo.com.ph @yahoo.com.my
1          0.02%  dubai wines manufacturers and imports and exports@yahoo.com@gmail.com@hotmail.com
1          0.02%  duke martins expoter and importer of raw and industrial materials
1          0.02%  dump truck supplier in asia @163.com @126.com @yahoo.com @hotmail.com
1          0.02%  dynamic stabilization in the surgical management of painful lumbar spinal disorders pdf
1          0.02%  e .mail livi ltd @vip. 163 com
1          0.02%  e cells and materials impact factor
1          0.02%  e cells and materials journal
1          0.02%  e cigarette @yahoo
1          0.02%  e mail ga school @hatmail com
1          0.02%  e-mail 2012 2013 @yahoo.com @arab.net @turkey.com @iran.net @allemails.com @aol.com @eim.ae @yahoo.com @yahoo.com.cn @gmail.com
1          0.02%  e@gmx.de.dewanadoo.fr yahoo gmail hotmail@ emailchristoph
1          0.02%  e_ mail melan_ p %40u ukr. net cq
1          0.02%  easy-graft and bone regeneration
1          0.02%  ec2-107-20-248-121.compute-1.amazonaws.com/oapi/l
1          0.02%  ecell and material
1          0.02%  ecell journal
1          0.02%  ecells
1          0.02%  ecells and materials journal 影响因子
1          0.02%  ecg buyer @gmail
1          0.02%  ecm 2013
1          0.02%  ecm chairman @yahoo hotmail gmail
1          0.02%  ecm conference 2013
1          0.02%  ecm duttenhoefer
1          0.02%  ecm gasser
1          0.02%  ecm griboi
1          0.02%  ecm high res
1          0.02%  ecm in trauma applications
1          0.02%  ecm jornal statistiken 1992 porno
1          0.02%  ecm journal .org/hotmail
1          0.02%  ecm journal comprehensive review on bone
1          0.02%  ecm journal interlaken meet the experts
1          0.02%  ecm journal publication fee
1          0.02%  ecm journal statistiken 1992 porno 200 907
1          0.02%  ecm journalö
1          0.02%  ecm suppl paper
1          0.02%  ecm xiv
1          0.02%  ecm xv: cartilage
1          0.02%  ecmjournal
1          0.02%  ecmjournal .org statistiken 1992 mein erster porno
1          0.02%  ecuador furnitures suppliers list @yahoo.com@hotmail.com@gmail.com.xls
1          0.02%  eddie @yahoo.com @aol.com @gmail.com @hotmail.com txt 2013
1          0.02%  ediward@att.net@hotmail.com@aol.com@gmail.comtxt2013
1          0.02%  eduardo @yandex.br @hotmail.br -
1          0.02%  eduardo sanz 31@yahoo.com
1          0.02%  eduardo@gmail.com@aol.com@msn.com@tampabay.rr.com@yahoo.com txt 2013
1          0.02%  edwards@aol.com@yahoo.com@hotmail.com 2013 txt
1          0.02%  eei @ streamyx.com
1          0.02%  effect of electric field on fracture healing pdf
1          0.02%  effect of electromagnetic radiation for fracture healing pdf
1          0.02%  effect of substrate on property magnetic nanowire pdf
1          0.02%  effects of carbon fiber in soft tissue
1          0.02%  effects of endothelial cells on human mesenchymal stem cell activity in a three-dimensional in vitro model
1          0.02%  egypt medical doctors 2013 update members emails contacts @ eim.ae
1          0.02%  egypt nasser 2013/2014@aol.com@yahoo.com@hotmail.com@gmail.com
1          0.02%  egypt pipe exporters @yahoo.com @hotmail.com
1          0.02%  egyptian cotton exporters egypt @aol.com@ yahoo.com@gmail.com@hotmail.com guest book 2013
1          0.02%  egyptian manufactures company of wine and email contact @hotmail.com
1          0.02%  ehab/mostafa in ethiopia email address@hotmail.com yahoo.com/@tu.edu.sa
1          0.02%  eihteen.hotwet.tv
1          0.02%  electric wire importers @sinos.net
1          0.02%  electrical stimulation protocols for non union fracture
1          0.02%  electron diffraction and high-resolution transmission electron microscopy in the characterization of calcium phosphate precipit
1          0.02%  electronic manufacturer in vietnam @yahoo.com
1          0.02%  electronic washing machine @aol.com @ gmail.com @126.com @hotmail.com @163.com asia txt 2013
1          0.02%  electronics dealers in japanyahoogmailhotmail
1          0.02%  electronics dealers@yahoo.com.au @hotmail.com @gmail.com
1          0.02%  electronicwarehouse@ymail.com
1          0.02%  electrospinning 3d
1          0.02%  electrospinning peg
1          0.02%  eletricalwire products importersexportersmanufacturerdealers in china@hotmailyahoogmail.com
1          0.02%  ella yahoo.com @aol.com gmail.com txt 2013 emaillist
1          0.02%  email 2013 xls rose@mail.ru
1          0.02%  email @yahoo.com@hotmail.com@gmail.com@mohammed
1          0.02%  email address @yahoo.com @sbcglobal.net @cox.net @aol.com @gmail.com @earthlink.net u
1          0.02%  email address of chemical sellers in asia @yahoo.hotmail.com.gmail.com
1          0.02%  email address of importersexportersconstruction companies manufacturers building materials or factory materials for tailoring m
1          0.02%  email address parts suppliers in usa chinahongkong @hotmail@livemsnoutlook
1          0.02%  email addresses and contact informations guest book of persons in indonesia
1          0.02%  email addresses of company ceos managers (dr) in asia (@yahoo.com.my) (@aol.com) (@hotmail.com) (@live.com) (@msn.com) (@gmail.
1          0.02%  email addresses of international business men in israel yahoo.com hotmail.com aol com 2013
1          0.02%  email addresses of ngo directors in asia
1          0.02%  email addresses of nicolas @cantv.net @gmail.com @yahoo.es @yahoo.com hotmail.com venezuela 2012/2013
1          0.02%  email amanda@bigpond.com txt
1          0.02%  email and addrese govement canada list numbers @yahoo.com @hotmail.com 2013
1          0.02%  email company 2013 addresses director au gold metal buyers
1          0.02%  email contact journals @yahoo.com 2013
1          0.02%  email contact list of oil companies nigeria yahoo hotmail gmail -spam -fraud -419
1          0.02%  email contact monnier.martch @bluewin.ch skynet.net gmail.com
1          0.02%  email contact mr y and mrs v @argentina post office
1          0.02%  email contact of asian companies directors@yahoo com 2013
1          0.02%  email contact of korean companies members @hotmail.com
1          0.02%  email contact of mrg. in indonesia @yahoo.co.in @gmail.com txt
1          0.02%  email contact of mrs. susan @show.ca @westnet.net @aol.com @comcast.net 2013
1          0.02%  email contact of nurses in saudi arabia yahoo com hotmail com sify com gmail com
1          0.02%  email contact of shoe manufacturers in taiwan yahoo.com hotmail 126
1          0.02%  email contact of truck seller in taiwan yahoo.com hotmail 126
1          0.02%  email contacts of all the transporters in algeria
1          0.02%  email contacts of fabric dealers in taiwan@yahoo.com@yahoo.tw 886
1          0.02%  email contacts of fertilizer manufacturers in philippines
1          0.02%  email contacts of gold bars buyers in usa jewelries market @ aol.comandgmail.com
1          0.02%  email contato g@bol.com.br @uol.com.br @gmail.com @zipemail.com @hotmail.com @yahoo.com.br @terra.com.br
1          0.02%  email database of milk company owners and distributors @yahoo.com.cn@hotmail.com@msn.com@gmail.com@yahoo.co.hk worldwide
1          0.02%  email directories of nigerian baby wears dealers and suppliers @yahoo.com
1          0.02%  email directories of nigerian electronics dealers and suppliers @yahoo.com
1          0.02%  email directory of saudi patial rug import/export companies @yahoo.com@hotmail.com
1          0.02%  email directory richard@hotmail.com 2013
1          0.02%  email dreambook and guestbook in slovensko 2013
1          0.02%  email from @gmx.de@web.de@t-online.de@freenet.de from oil and gas/petroleum germany
1          0.02%  email guessbook of businessmen @hotmail.com @gmal.com @yahoo.com.my txt 2013
1          0.02%  email importers and exporters in the philippines 2012 @yahoo
1          0.02%  email importers exporters suppliers buyers gmail.com yahoo.com alibaba.com 126.com 163.com
1          0.02%  email leads @gmail.com @aol.com @yahoo.com @hotmail.com
1          0.02%  email list @earthlink.net txt
1          0.02%  email list of consumer electronics supliers in china @126.com @163.com
1          0.02%  email list of suppliers of olive oil in china @163.com @126
1          0.02%  email list of textile materials suppliers in china indonesia @126.com @163.com
1          0.02%  email listing of loan seekers in singapore loan yahoo com sg @hotmail.com.sg
1          0.02%  email listing of manufacturers of steel pipe in asia @yahoo.comhotmail.com126.com163.comgmail.com
1          0.02%  email of whole of medical equepment and cars dealers in united state yahoo.com ymail .com .gmail.com net.com .live.comhotmaail 
1          0.02%  email pass:yahoo com gmail com hotmail com aol com comcast
1          0.02%  email@ steven fernandes
1          0.02%  email@ yahoo.com.vn
1          0.02%  email@yahoo.com 2013 indonesia
1          0.02%  emailaolgmailhot mailof a gold companies in japan
1          0.02%  emails @163.com126.comyahoo.comhotmail.com
1          0.02%  emails address of crude oil importer in india @yahoo.co.in @rediffmail.com @hotmail.co.in
1          0.02%  emails address of power pack distributors @gmail.com @aol.com @yahoo.com xls
1          0.02%  emails address of traders in libya@yahoo@hotmail.com
1          0.02%  emails contact managing directors 2013 @mail.ru @yahoo.com @rambler.ru
1          0.02%  emails directory of color heidelberg machine suppliers @yahoo
1          0.02%  emails for buyers and sellers in asia @yahoo
1          0.02%  emails of businessmen in switzerland @yahoo.com @hotmail.com @gmail.com @aol.com
1          0.02%  emails of companies in korea that buy or sell factory equipments @hanmail.net @daum.net @korea.com @163.com @126.com
1          0.02%  emails of companies that deal in tractors in korea @hanmail.net @daum.net @korea.com @163.com @126.com
1          0.02%  emails of women in need of loan @yahoomail.us @hotmail.us @gmail.us
1          0.02%  emails: 91 calcium 600 d @yahoo.co.in@gmail@hotmail2012 -scam
1          0.02%  emails@webmail.co.za@yahoo.co.za filetype xls
1          0.02%  emailsexchange.yas.nhs.uk/owa
1          0.02%  embryonic origin of the pulp
1          0.02%  emc jornal statistiken doris078
1          0.02%  emile.cheung@yahoo.com
1          0.02%  emile.cheung@yahoo.com@yahoomail.com@hotmail.com@gmail.com@aol.com 2012/2013 txt
1          0.02%  emilie.cheung@yahoo.com
1          0.02%  emmachem .email @
1          0.02%  eng.mohamed saad 93@yahoo.com
1          0.02%  engineer stephanie@aol.com @yahoo.com @gmail.com @hotmail.com 2010
1          0.02%  engineering @inbox.com @cox.net @aol.com 2013
1          0.02%  engineers in mexico @aol.com@yahoo.com@gmail.com.@hotmail.com@comcast.com
1          0.02%  englandasiadubaisingaporethailand@gmail.com@aol.com@msn.com..txt
1          0.02%  english sexø
1          0.02%  engr. @yahoo.com.au@hotmail.com.au@gmail.com.au txt
1          0.02%  enhances the inhabitation of mesenchymal stem cell on the proliferation in t cell
1          0.02%  enterprise @yahoo.com cn txt
1          0.02%  eric @gmail @sbcglobal.net@sifymail.com@fastermail.com@rediffmail.com@gmail
1          0.02%  eric @yahoo.es @hotmail.com @juno.com @netzero.net @earthlink.net @bellsouth.net 2012/2013
1          0.02%  eric@yahoo.com@hotmail.com@gmail.com@aol.com
1          0.02%  ericca 1115@yahoo.cn txt
1          0.02%  ericwatters1@cox.net
1          0.02%  eruopan porn tvs
1          0.02%  escort egept @gamil com
1          0.02%  establishment of a novel organic/inorganic matrix system—a possible stepping stone to controllable vasculo–/angiogenesis
1          0.02%  ethiopia dating email profile guest in asia online yahoomail@hotmail
1          0.02%  eur cells materials
1          0.02%  eur. cell. mater.
1          0.02%  eur. cells mater
1          0.02%  euro cell
1          0.02%  euro cell mater impact
1          0.02%  europaen cells and. m a t e r i a l s v o l . 2 5 2 0 1 3
1          0.02%  europe @yahoo.com@aol.com@hotmail.com@yahoo.co
1          0.02%  europe business @gmail.com @hotmail.com @yahoo.com @msn.com @aol.com txt 2013
1          0.02%  europe motorcycle parts
1          0.02%  europe@hotmail.com aol.com gmail.com txt
1          0.02%  european @email @2013 :txt
1          0.02%  european buyers %%% aol@yahoo %%%%gmail %%%%hotmail.eu 2013
1          0.02%  european cell and material
1          0.02%  european cell and material journal
1          0.02%  european cell and materials journal
1          0.02%  european cell and materials journal impact factor
1          0.02%  european cell material impact factor
1          0.02%  european cell materials impact factor
1          0.02%  european cells and materials (ecm)_materials science_1473-2262_9.650_
1          0.02%  european cells and materials abbreviation
1          0.02%  european cells and materials angiogenic competency
1          0.02%  european cells and materials conference
1          0.02%  european cells and materials vol. 26. suppl
1          0.02%  european cells and materials vol.16 2008 hearnden
1          0.02%  european cells and materials volume 26
1          0.02%  european cells material
1          0.02%  european cells materials
1          0.02%  european cells materials journal
1          0.02%  european contractors members directory and guest book @gmx.de
1          0.02%  european journal of biomaterials
1          0.02%  european journal of material
1          0.02%  european journal ofmaterial
1          0.02%  europen cells and materials
1          0.02%  eva curtis my facebook @yahoo .com
1          0.02%  exclusive nigeria scams 2013 @yahoo @aol @hotmail
1          0.02%  executive members of maharashtra live email address 2013 live com yahoo com gmail com hotmail com yahoo in rediffmail com
1          0.02%  executive private hotmail.com @ aol.com 2013
1          0.02%  exercises that stimulate bone healing
1          0.02%  experimental and modeling studies of oxygen tension in vascular tissue engineering with and without an oxygen carrier
1          0.02%  export import companies in china@aol@gmail@hotmail@yahoo.com
1          0.02%  exporter @yahoo.com.cn @163.com contacts
1          0.02%  exporter and industry sporting contact fax hotmail comyahoomail.com -fruad/scam
1          0.02%  exporter companies in cambodia @yahoo.com @hotmail.com @gmail.com
1          0.02%  exporters 2013filetype:txt @qq.com or @163.compassword:***
1          0.02%  exporters @yahoo.com.cn
1          0.02%  exporting company with email links@hotmail.com@gmail.com@yahoomail.com@ymail.com@rocketmail.com
1          0.02%  exports of goldcrystal and diamon in roman 39@yahoo.com @hotmail.com @gmail.com
1          0.02%  ext pdf intext:regional @aol.com @sbcglobal.net @comcast.net @aol.com
1          0.02%  ext txt password sandi santhiago @gmail
1          0.02%  ezproxy du.ac.bd login
1          0.02%  f-8#as_qdr=all
1          0.02%  fabric companies in turkey @mail.com.tk%@yahoo.com %@gmail.com . ltd 2013
1          0.02%  fabric related companies contact@*usa.com lebanon tn usa
1          0.02%  facebook @yahoo com @gmail com @ sbcglobal net @ aol com 2013
1          0.02%  facebook emails @yahoo.com @gmail.com @aol.com @comcast.com @mail.com 2013
1          0.02%  facebook members email greoge@yahoo.com@hotmail.com@gmail.com@aol.com xls
1          0.02%  facebookporn from softballsaint@yahoo
1          0.02%  factory email 2013@yahoo.com@gmail.com@aol.com 2013 txt
1          0.02%  fahad @gmail.com @yahoo.com 971@hotmail.com
1          0.02%  fahad don 786786 @yahoo co uk
1          0.02%  fahad@gamil.com @yahoo.com .qa @hotmail.com.qa
1          0.02%  fahad_nancyyahoo.com
1          0.02%  farhanyahoo@ united kingdom
1          0.02%  farmers of canada @yahoo.ca @aol.com @gmail.com @hotmail.com
1          0.02%  farmers union sbcglobal.net aol.com yahoo.com.au bellsouth.net directory 2013
1          0.02%  fast red tr mesenchymal stem cells
1          0.02%  fax 62 @gmail.com @hotmail.com 2012/2013
1          0.02%  fax 92 baloch @yahoo.com.pk @hotmail.pk @gmail.com @yahoo.com txt
1          0.02%  fax: 1mark@hotmail.com@yahoo.com@aol.com@gmail.com2013
1          0.02%  fax: 359 jack@aol.com@hotmail.com@gmail.com2013
1          0.02%  fax; 1 bill@yahoo.com@hotmail.com@gmail.com@aol.com2013
1          0.02%  fax; 1jean@yahoo.com@hotmail.com@gmail.com@aol.com2013
1          0.02%  fecebook/www com@
1          0.02%  federation of canadian chambers of commerce and industry directory @gmail.com @webmail @comcast.net @hotmail.com
1          0.02%  fedinad @aol.com txt
1          0.02%  feg87@hotmail.com
1          0.02%  ferro silicon buyer
1          0.02%  ffuking machin sax
1          0.02%  fiber intext: brazil inurl: contacts intext: email intext: tel
1          0.02%  fiber intext: cambodia intext: email filetype txt inurl: contacts producers
1          0.02%  fietype:ctt yahoo 2013
1          0.02%  fiji island directors email contact 2013 traders@yahoo.co.fj
1          0.02%  fiji@yahoo.com.co.uk@hotmail.com@gmail.com@aol.com@sbcglobal.net@myway.net@att.net@ymail.com
1          0.02%  filetype : mohammed @yahoo.com.sa
1          0.02%  filetype :ctt hotmall
1          0.02%  filetype ctt facebook2011
1          0.02%  filetype ctt gxm
1          0.02%  filetype ctt yahoo aol.fr
1          0.02%  filetype ctt yahoo girl
1          0.02%  filetype txt: @yahoo.co.uk marina.co.uk
1          0.02%  filetype.ctt hotmail.com
1          0.02%  filetype:ctt hotmail.ie
1          0.02%  filetype:ctt yahoo.ie
1          0.02%  filetype:txt intext:@gmal.com @yahoo.com intext:2go intext:password
1          0.02%  filetype:txt young @yahoo.ca 2013
1          0.02%  find business email addresses australia @yahoo.com@hotmail.com@gmail.com@web.de@sbcglobal.com txt 2013
1          0.02%  firstanal.hotwet.tv
1          0.02%  fish exporters in china @126.com sales@
1          0.02%  fluid shear force and turbulence-induced cell death in plastic
1          0.02%  fluorescence polarization anisotropy adherent attached glass cells
1          0.02%  foods manufacture inchina email @yahoo.com filetypedf or filetypeoc orfiletypels
1          0.02%  footwears suppliers philippines @yahoo.cn @yahoo.com.cn @hotmail.com @live.cn @gmail.com @126.com
1          0.02%  forming chondrocyte in chondrogenesis micromass culture
1          0.02%  foto lisa dewi @yaho
1          0.02%  fourier transform infrared imaging cartilage
1          0.02%  fracture consolidation current concept
1          0.02%  fracture repair in canines
1          0.02%  france spain zinc scrap battery scrap nickel scrap dealer buyer/email fax @hotmail.com xls filetype
1          0.02%  francesca 63 @gmil .con
1          0.02%  francesca10050 alice texas inquires
1          0.02%  francisca @aol.com @bellsouth.net @sbcglobal.net @verizon.net txt
1          0.02%  frank williams newmail group @yahoo.com @hotmail.com
1          0.02%  frank yahoo.com hotmail.comfiletypels
1          0.02%  franklin@yahoo.com @hotmail.com @gamil.com @aol.com.txt.2013
1          0.02%  franxesca 63 @gmil .com
1          0.02%  franziska benutzername und passwort@arcor.de web.de freenet.de gmx.de yahoo.de august 2013
1          0.02%  frau willms porno movie
1          0.02%  free love dating email profile guest in asia online yahoomail@hotmail
1          0.02%  free mobile video @naught american mother
1          0.02%  free online dating at free personalclassifieds.com with email@yahoo.de @gmail.at @hotmail.de @livemail.at
1          0.02%  free pkistani porn tv online
1          0.02%  free porn malysia girl @12 years old fucking
1          0.02%  freeporn youtube per samsung gt-s5230 edge quad band
1          0.02%  freesex egeptin atist
1          0.02%  freon gmail.com kuwait
1          0.02%  friends. mexican .yahoo
1          0.02%  from irans e-mail company 98@hotmail.com @company.ir @gmail.com 2013
1          0.02%  fsu foodconsult@yahoo.com
1          0.02%  ftp0002.heraeus.com
1          0.02%  ftp://shop:1828@ftp2.belle.com.hk
1          0.02%  fuck white big bbw barayil
1          0.02%  fuck@yahoocom@hotmailcom@gmail.com@rediffmail.com@ymail.com
1          0.02%  fucked on the bed @pix and vids
1          0.02%  ful video videos sex usa shamaels girls
1          0.02%  fulsex masarat shahen
1          0.02%  funiture email *@126.com
1          0.02%  funny porno ost land str. 7 doris 078
1          0.02%  furniture and textiles factories in china@hotmail.cn@live.cn@gmail.com@yahoo.cn
1          0.02%  furniture importer@
1          0.02%  g.hussain 67@ .yahoo com.
1          0.02%  gabriel@gmail.com@yahoo.com@aol.com@hotmail.ccom 2013
1          0.02%  gambia penpals@yahoo.com@gmail.com@hotmail.com@redifmail.com@aol.com
1          0.02%  garment buyers and/or importer @ email .xls or .db download
1          0.02%  garments / leathers @hotmail.com@gmail.com@eim.ae@emirates.net.aedubai
1          0.02%  garry@aol @comcast @hotmail @gmail @yahoo latest
1          0.02%  garywolf@pacbell.net
1          0.02%  gas company @comcast.net@gmail.com@cox.net@bellsouth.net@yahoo.fr 2013
1          0.02%  gayboy devilfinder
1          0.02%  general industrial equipment in china@gmail.com@hotmail.cn@yahoo.cn@live.cn
1          0.02%  general.james42@yahoo.com
1          0.02%  genesis bone stimulater
1          0.02%  geoffrey @yahoo.com hotmail.com gmail.com aol.com rediff.com
1          0.02%  george @ parseek. ca @ mail.ru @ yahoo. it 2013
1          0.02%  george2012@aol.comtxt
1          0.02%  george@hotmail.com @aol.com @earthlink.net @cox.net @msn.com @yahoo.com @sbcglobal.net @verizon.net @mail.ru @gmail.com txt
1          0.02%  george@hotmail.com txt
1          0.02%  george@yahoo.com @hotmail.com @gmail.com @juno.com @aol.com @sbcglonal.net txt
1          0.02%  gerald@yahoo.com.uk gerald@hotmail.com.ca gerald@gmail.com.br gerald@aol.com.hk csv
1          0.02%  gerald@yahoo.com.uk@hotmail.com@aol.com@sbcglobal.com
1          0.02%  geraldine@ 81 hotmail.com
1          0.02%  gerber i and differentiation of rat
1          0.02%  german company email@yahoo.di@gmx.de@hotmail.de@live.de 2013
1          0.02%  germany @gmail.com participants 2012 list xls file
1          0.02%  germany @tiscali.de@web.de@gov.de@inbox.de email leads
1          0.02%  germany @yahoo.de
1          0.02%  germany business list @yahoo.de
1          0.02%  gerry rocketmail@yahoo.com
1          0.02%  gibson@yahoo.com@verizon.net@aol.com@gmail.com@sbcglobal.net@hotmail.com txt 2013
1          0.02%  giftsamuel52@yohoo.com
1          0.02%  ginamohammed97@yahoo.com
1          0.02%  girl friend suzy @hot mail.comfacebook
1          0.02%  glass supplier @yahoo.com hotmail.com gmail.com qq.com 126.com 163.com
1          0.02%  glenn@yahoo.co.uk glenn@hotmail.com.qa glenn@gmail.com.ca glenn@rocketmail.com.hk glenn@aol.com csv
1          0.02%  global business executives 2013 @aol.com @msn.com @cox.net @gmail.com
1          0.02%  global industies in spain @hotmail.com
1          0.02%  global profusion workers contact emails @yahoo.com@hotmail.com@aol.com@gmail.com@comcast.net
1          0.02%  glutamate receptor cascade signalling
1          0.02%  glutamate stretch cell
1          0.02%  gmail.com @aol.com @yahoo.de @hotmail.com @comcast.net
1          0.02%  godwin @yahoo.com @hotmail.com @gmail.com 2010 usa tx 2013
1          0.02%  godwin lilian 52@ yahoo in
1          0.02%  gogal.com/google-maps.htmlafdt=
1          0.02%  gold buyers supplies 2013 @aol.net yahoo.in hotmail.com @gmail.com
1          0.02%  gold company in world emails@yahoo.com@gmail.com@mail.com@hotmail.com
1          0.02%  gold importer exportersmanufacturerdealers in india @yahoohotmailgmail.com
1          0.02%  goldbuyers@hotmail.com
1          0.02%  gonz.xxx .www.
1          0.02%  google quran read pen @omantel.net.om
1          0.02%  google usa.com 1 smith email addresses @yahoo.comgmail.comhotmail.com 2013
1          0.02%  google.com/mclient=ms-nokia
1          0.02%  google@ come@ pk
1          0.02%  google@ yahoo .com
1          0.02%  googleسكس اولاد
1          0.02%  grace@live.co.au @yahoo.co.au @gmail.com 2013 txt ( australia )
1          0.02%  greatest sale inc@126.com @163.com @hotmail.com
1          0.02%  grey @yahoo.cayahoo.comyahoo.atyahoo.fryahoo.royahoo.co.uk 2012/2013 leads
1          0.02%  grey@gmails.com@hotmails.com@yahoomails@aol.com2013.
1          0.02%  guest book .in kuwait @yahoo.com @hotmail.com @aol.com
1          0.02%  guest book @yahoo.se
1          0.02%  guest@ animal vs grils sex my wap.com
1          0.02%  guest@ my porn wap
1          0.02%  guestbook hurt 2013@yahoo.com @aol.com @hotmail.com @comcast.net txt
1          0.02%  guestbook in usa @ gmail.com @ yahoo.com @ hotmail.com
1          0.02%  guestbook of yahoo.ch
1          0.02%  gun ltd.co @163.com @qqmail.com @yahoo.com 2013
1          0.02%  h arzate ligament stem cells
1          0.02%  h ttp// hind sex bideo
1          0.02%  h2o porn movie free @sex movie
1          0.02%  hafiz@gmail.com@aol.com@comcast.net@yahoo.com@hotmail.com.txt./2011
1          0.02%  hameedu@rba.gov.au
1          0.02%  hamilton@yahoo.com.uk hamilton@rocketmail.com.ca hamilton@hotmail.com.hksmith@gmail.com.qa hamilton@aol.com csv
1          0.02%  hamza 44 gmail@ com
1          0.02%  handimovej bijans
1          0.02%  hang@gmail.com@yahoo.com.hk@hotmail.com.txt
1          0.02%  hann@comcast.net @gmail.com @aol.com txt 2013
1          0.02%  hannah@live.co.au @yahoo.co.au @gmail.com 2013 txt ( australia )
1          0.02%  harris l.g foster s.j richards s. g. (2002). an introduction to staphylococcus aureus and techniques for identifying and quanti
1          0.02%  harrison:@hotmail.frhotmail.fr filetype txt update
1          0.02%  hart 2013 @yahoo.com @hotmail.com @aol.com @gmail.com
1          0.02%  hassan @gmail.com @hotmail.com 2013
1          0.02%  hassan@gmail.com @hotmail.fr @yahoo.ca. 186 2012.cvs
1          0.02%  hassan@yahoo.com 2013 txt
1          0.02%  hassan@yahoo.com@gmail.com@hotmail.com in 2013 - scam
1          0.02%  hd camera@yandex.ru
1          0.02%  heavy machenary dealers@126.com@163.com@yahoo.com@hotmail.com@gmail.com@aol.com 2013
1          0.02%  helda @yahoo.ca @shaw.ca @canada.com @wannado.ca
1          0.02%  helen@yahoo.com @gmail @hotmail.com
1          0.02%  helene otto 43@ jahoo.de
1          0.02%  helin@yahoo.com@gmail.com@hotmail.com@txt
1          0.02%  helmi azizi @hotmail .com
1          0.02%  helne@yahoo.com@hotmail.com/ 2013
1          0.02%  help@live.comgmail.com@aol.com@msn.com@yahoo.co.uk@att.nettxt2013
1          0.02%  henrik@aol.com@gmail.com@yahoo.com 2010 txt
1          0.02%  henry in usa @yahoo.com @hotmail.com @juno.com 2012 2013
1          0.02%  hhmi.janelia.mailorg/owa
1          0.02%  hhttp//www.googlefacebook.com
1          0.02%  hi ba qatar@ gmail
1          0.02%  hiast.biggest.pussysex
1          0.02%  hindi singer pourima vedio songs
1          0.02%  hiraen xxx sex
1          0.02%  hl=tr
1          0.02%  home owners in usa@aol.com@yahoo.com@gmail.com@hotmail.com guestbook 2013
1          0.02%  honey raaj 93@ gmail.com
1          0.02%  hong iron steel company email contact @yahoo.com.hk@gmail.com@info.com@hk.net@hotmail.com
1          0.02%  hong kong 852 board of directors @info @gmail.com @rediffmail.com
1          0.02%  hong kong motocycle manufacture @yahoo.co.fr @hotmail.com @126.com @aol.com @gmail.com@163.com@qq.com
1          0.02%  hong kong muslim directory @yahoo.com.hk
1          0.02%  hong kong rubber manufacturers directory @gmail.com @yahoo.com.hk
1          0.02%  hong kong suppliers directory @yahoo.com.hk @gmail.com
1          0.02%  hongkong@yahoo.com.hk @gmai.com.hk @hotmail.com.hk email compilation 2013 txt
1          0.02%  hot naked lesibiansgirls.porn poly
1          0.02%  hotmail contacts email healing @yahoo.com.ph in phillipines 2013
1          0.02%  hotmail senha 2013 filetype .txt
1          0.02%  hotmail.com @yahoo.com @gmail.com 2013
1          0.02%  hotmail@gmail@yahoo@globo
1          0.02%  hotmail@usman uae
1          0.02%  house agents in usa@aol.com@yahoo.com@gmail.com@hotmail.com guestbook 2013
1          0.02%  how carbon is applied in medicine
1          0.02%  how open iobnet mobi proxy for mobile samsung sgh-e250i
1          0.02%  how to co culture cells
1          0.02%  how to culture human osteoblasts
1          0.02%  how to test cell viability of chondrocyte pellets in culture
1          0.02%  how to treat prolapse intervertebral disc pdf
1          0.02%  hpmc @sinos.net
1          0.02%  hpmc importer @hotmail
1          0.02%  hpmc wholesaler/ buyer email
1          0.02%  hq=link-container
1          0.02%  htbl uvfn 20013
1          0.02%  http//tranalategoogle//zhcnen
1          0.02%  http//www.nastyvid
1          0.02%  http3gpvideo://www.msn.com/
1          0.02%  http://abdu1.wen.ru/music/q.html
1          0.02%  http://au.search.yahoo.com/searchfr=ubuntu
1          0.02%  http://azbul.net/2012/en-in/فلم ايراني كون سكسى.html
1          0.02%  http://ec2-107-20-248-121.compute-1.amazonaws.com/oapi/lp.jsp;jsessionid=0661de1fb482661012313f2566df04d0.f136
1          0.02%  http://en-maktoob.porngirl.yahoo.com/
1          0.02%  http://fietybe:tt:yhoo
1          0.02%  http://in.search.yahoo.com/r/_ylt=a0ogkmegur1s5d8age67hax.;_ylu=x3odmtbzaddmy3y5bhnlywnzcgrwb3mdnzaey29sbwnzazeednrpzam-/sig=12
1          0.02%  http://in.search.yahoo.com/r/_ylt=a0ogkmegur1s5d8agk67hax.;_ylu=x3odmtbzc2hwdnvrbhnlywnzcgrwb3mdnzeey29sbwnzazeednrpzam-/sig=12
1          0.02%  http://m.baidu.com/sword=i___…
1          0.02%  http://m.facebook.com/l.phpu=http://wap.zong.com.pk/
1          0.02%  http://movievideo.me/search/geogle
1          0.02%  http://remix.wen9.cnm
1          0.02%  http://spamdb.vp44.com/list_replyto.phppid=9 in nig
1          0.02%  http://spamdb.vp44.com/list_replyto.phppid=9 in nigeria 2013 email.com
1          0.02%  http://tightpussy18.com/
1          0.02%  http://tubelive.uni//index2
1          0.02%  http://www.18qt.com/niches/bigass1.shtml
1          0.02%  http://www.binrand.com/post/sbcglobal.net/2013
1          0.02%  http://www.bzu.edu.pk/news/index.phpcategoryid=2
1          0.02%  http://www.ecmjournal.org/journal/papers/vol002/pdf/v002a03
1          0.02%  http://www.ecmjournal.org/journal/papers/vol008/pdf/v008a06
1          0.02%  http://www.ecmjournal.org/journal/papers/vol019/pdf/v019a06
1          0.02%  http://www.ecmjournal.org/journal/papers/vol021/vol021a29.php
1          0.02%  http://www.ecmjournal.org/stats/ref_201001.html
1          0.02%  http://www.ecmjournal.org/stats/ref_201107.html
1          0.02%  http://www.ecmjournal.org/stats/ref_201211.html
1          0.02%  http://www.ecmjournal.org/stats/ref_201304.html
1          0.02%  http://www.ecmjournal.org/stats/search_201003.html
1          0.02%  http://www.ecmjournal.org/stats/search_201201.html
1          0.02%  http://www.ecmjournal.org/stats/search_201206.html
1          0.02%  http://www.ecmjournal.org/stats/search_201207.html
1          0.02%  http://www.ecmjournal.org/stats/search_201210.html
1          0.02%  http://www.ecmjournal.org/stats/search_201212.html
1          0.02%  http://www.ecmjournal.org/stats/search_201303.html
1          0.02%  http://www.elfqrin.com/hacklab/menu/library.php .torrent
1          0.02%  http://www.goldrate24.com/gold-prices/africa/nigeria/
1          0.02%  http://www.google.co.uk/searchsafe=off
1          0.02%  http://www.google.com.mx/searchhl=es
1          0.02%  http://www.google.com.pk/webhphl=ur
1          0.02%  http://www.google.com/mq=g00gle5000.
1          0.02%  http://www.google.com/mq=korea hot models
1          0.02%  http://www.google.com/mq=www.doi
1          0.02%  http://www.google.com/searchclient=ms-nokia
1          0.02%  http://www.google.com/searchhl=es
1          0.02%  http://www.google.com/searchq=free younger girls sex 13 years old picture.com
1          0.02%  http://www.google.com/searchsourceid=navclient
1          0.02%  http://www.google.com/xhtmlclient=ms-motorola_mb_mf
1          0.02%  http://www.google.com/xhtmlq=www hayvan kadın porno izle
1          0.02%  http://www.info.com/sexqkw=sex
1          0.02%  http://www.izlesem.org/ossu-oo1.html
1          0.02%  http://www.nokia.com/mea-arمقاطع ‏هندي سكس
1          0.02%  http://www.sexian.net/xxx3com.htm
1          0.02%  http://www.therichboy.com/unsubscribe/suppression-list.txt
1          0.02%  http://www.videoo.nl/tag/blond
1          0.02%  http://www.xxxtree.com/tubes/egyptian1.php
1          0.02%  http;//116.1.3.166;8090/
1          0.02%  https://email.global.com.kw
1          0.02%  https://webmail ac.uk password url/host login 2012
1          0.02%  https://www.google.com/searchq=isca sol ioni
1          0.02%  httpwww.18qt.comnichesshemale1.shtml
1          0.02%  httpwww.goldporntube.comcategories.shtml
1          0.02%  huge eyed @hotmail.com@bellsouth.net@gmail.com@yahoo.com txt 2011
1          0.02%  hulbert et al. 1970
1          0.02%  human stem cells and articular cartilage regeneration
1          0.02%  hunkong iphone sex.3gp
1          0.02%  hussein @yahoo.com @hotmail.com txt 2013
1          0.02%  hutmacher dw. scaffolds in tissue engineering bone and cartilage
1          0.02%  hyaluronic acid ft-ir spectra
1          0.02%  hydraulic hose @wannado.fr
1          0.02%  hydrogel spinal disc regeneration
1          0.02%  i am scientifical enginering from south korea email guest book gmail.com of 2013
1          0.02%  i dringend brauche einen kredit von 7000 € @online.de @hotmail.com 2013
1          0.02%  i hasan @hotmail.com @gmail.com @msn.com @maktoob.com txt 2013
1          0.02%  i leeds for 50000 euro@hotmail.de@gmail.de2013
1          0.02%  i moet.iin 69@ yahoo.co.id
1          0.02%  i need a hitel 10000 urgently@hotmail.com @ yahoo.com @ gmail.com 2013
1          0.02%  i need a loan @@@hotmail @@@@mail @@@@@yahoomail @@@@@@rocketmail @@@@@@gmail @@@@@@aumail @@@@@@@aolmail
1          0.02%  i need a loan @gmail. com @yahoo. com @sifymail. com
1          0.02%  i need a loan @gmail.de@hotmail.de
1          0.02%  i need a loan @gmail.mx@hotmail.mx@yahoomail.mx
1          0.02%  i need a loan @mai..ru @yahoo.com @gmail.com
1          0.02%  i need a loan @yandex.ru @mail.ru
1          0.02%  i need a loan in united state@yahoo.com @gmail.com @hotmail.com
1          0.02%  i need a loan in usa @gmail.com @yahoo.com @hotmail.com
1          0.02%  i need a loan of 15000@gmail.com @yahoo.com
1          0.02%  i need a loan of 20000usd now please @yahoo.com @gmx.net
1          0.02%  i need a loan please help me at may 2013 @yahoo.com @yahoo.co.za @gmail.com @hotmailcom
1          0.02%  i need a loan to pay my bills 2013 @live.com @hotmail.com @yahoo.com @gmail.com
1          0.02%  i need a loan urgent @bresnan.net @suddenlink.net @comcast.net
1          0.02%  i need a loan urgently in 2013 @mail.es @gmail.es @yahoo.es
1          0.02%  i need a loan@@gmail.com@hotmail.com@yahoo.com
1          0.02%  i need a loans in usa 2013 @gmail.com @hotmail.com @yahoo.com @live.com
1          0.02%  i need a loans in usa 2013 @yahoo.com @gmail.com @hotmail.com
1          0.02%  i need an urgent loan 2013 @hotmail.com @yahoo.com
1          0.02%  i need an urgent loan 2013@mail.yandex.ru
1          0.02%  i need an urgent loan @gmail.es @yahoo.es @hotmail.es
1          0.02%  i need an urgent loan @gmail.sk @yahoo.sk @hotmail.sk
1          0.02%  i need an urgent loan amount 30000euro in france
1          0.02%  i need an urgent loan of $10 000 00.@mail.ru @yahoo.com @gmail.com @att.net @hot mail.com
1          0.02%  i need an urgent loan to buy a car@yahoo.co.uk @hotmail.co.uk @live.co.uk
1          0.02%  i need an urgent loan/ 2013 in czech @gmail.co.cz @yahoo.co.cz @hotmail.co.cz @inboxco.cz
1          0.02%  i need an urgnt loan@gmail.es @ yahoo.es @ hotmail.es
1          0.02%  ich bin für ein darlehen von 10.000 € suchen @web.ch @gmx.ch
1          0.02%  ich brauche dringend darlehen in deutschland @gmx.de @yahoo.ch @mail.de @web.de 2013
1          0.02%  ich brauche dringend darlehen in deutschland heute @web.de 2013
1          0.02%  ich brauche dringend darlehen in höhe von 1.000 € @gmx.ch @web.de @aol.de 2013
1          0.02%  ich brauche dringend darlehen in höhe von 10.000 € 2013 @yahoo.de @live.de @web.de
1          0.02%  ich brauche dringend darlehen in höhe von 20.000 € 2013
1          0.02%  ich brauche dringend einen kredit 2013 @t-online.de @web.de @gmx.de
1          0.02%  ich brauche dringend einen kredit 2013 @yahoo.com @yahoo.ch @yahoo.de @hotmail.com @hotmail.ch @hotmail.de
1          0.02%  ich brauche dringend einen kredit von 5000 euro im german@hotmail.de
1          0.02%  ich brauche dringend loan@gmail.com @ yahoo.com @ hotmail.com @ aol.com 2013
1          0.02%  ich brauche ein darlehen mir helfen @web.de @gmx.de txt
1          0.02%  ich brauche ein legit darlehen kreditgeber urgengly
1          0.02%  ich brauche ein unternehmen darlehen 2013 @aol.de @yahoo.de
1          0.02%  ich brauche eine dringende darlehen 2013 @gmx.de @yahoo.de @hotmail.de @email.de
1          0.02%  ich brauche eine dringende darlehen 2013 @gmx.de mail.de
1          0.02%  ich brauche eine dringende darlehen 2013 @web.de
1          0.02%  ich brauche eine dringende darlehen 5.000 € 2013
1          0.02%  ich brauche eine dringende darlehen 5000 euro 2013
1          0.02%  ich brauche eine dringende darlehen @web.de @hotmail.de
1          0.02%  ich brauche eine dringende darlehen beitrag standort @online.de @gmx.de 2013
1          0.02%  ich brauche eine dringende darlehen nach 2013 @web.de @hotmail.de @t-online.de @gmx.de
1          0.02%  ich brauche einen kredit 2013 @gmail.com
1          0.02%  ich brauche einen kredit 2013 @gmail.com @gmx.at
1          0.02%  ich brauche einen kredit 2013 @hotmail.de @yahoo.de @gmx.de @web.de
1          0.02%  ich brauche einen kredit @hotmail.de @gmx.de @web.de 2013
1          0.02%  ich brauche einen kredit @yahoo.de @gmx.de
1          0.02%  ich brauche einen kredit @yahoo.de @web.de 2013
1          0.02%  ich brauche einen kredit in deutschland @@@hotmail.comde @@@gmx.de @@@live.de
1          0.02%  ich brauche einen kredit in höhe von 20000 chf heute 2013
1          0.02%  ich brauche einen kredit in höhe von 50.000 € einen business@hotmail.de @ yahoo.de @ gmail.de starten
1          0.02%  ich brauche einen kredit in höhe von 50.000 € in 2013 deutsch ad
1          0.02%  ich brauche einen kredit in höhe von 5000 € in deutschland @web.de
1          0.02%  ich brauche einen kredit in höhe von 9.000 € 2013 @web.de @gmail.com @gmx.at
1          0.02%  ich brauche einen kredit persönliche darlehen in höhe von € 5.000 in deutschland in 2013@gmail.de @ yahoo.de @ hotmail.de @
1          0.02%  ich brauche einen kredit von 20.000 euro in deutschland @bluewin.ch 2013
1          0.02%  ich brauche einen kredit von 200.000 @yahoo.ch @hotmail.ch @bluewin.ch 2013
1          0.02%  ich brauche und urgenly darlehen
1          0.02%  idonasia.video.xnxx
1          0.02%  ik ben magdalena ik ben van nederlands ik moet dringend loan@live.nl
1          0.02%  ik heb een lening dringend 2013 @yahoo.de @hotmail.de
1          0.02%  ik heb een loan@hotmail.in @ yahoo.in @ gmail.ni
1          0.02%  ik moet een dringende lening van € 20.000 in nederland 2013 @hotmail.com @gmail.com
1          0.02%  image1.bobbystube.com
1          0.02%  implant pull out test from animal bone
1          0.02%  import and export of car @yahoo.com @163.com @hotmail.com
1          0.02%  import and export traders @yahoo.com
1          0.02%  import export companies in hong kong @yahoo.com.hk @hotmail.com.hk
1          0.02%  import export suppliers metal @yahoo @hotmail @gmail
1          0.02%  import mould%40%40cyber.net.
1          0.02%  import mould@@cyber.net.
1          0.02%  import rubber @hotmail.com @gmail
1          0.02%  import/export traders in lebanon @hotmail.com @terra.net.lb
1          0.02%  importer and exporter of building materials @yahoo.com.cn@yahoo.hk@yahoo.com
1          0.02%  importer and exporter of cars in china and philippines@@@yahoo@@@hotmail@@@gmail@@@aol@@@126@@@163.co
1          0.02%  importer and exporter of rice in china and philippines@@@yahoo@@@hotmail@@@gmail@@@aol@@@126@@@163.co
1          0.02%  importer of cloths in bruner darusallams @yahoo.com xls
1          0.02%  importers and exporters @yahoo.com @gmail.com @hotmail.com @live.com @126.com @163.com
1          0.02%  importers and exporters @yahoo.com@gmail.com@hotmail.com
1          0.02%  importers and exporters of beauty care instruments in france@yahoo.com or @gmail.com or @hotmail.com
1          0.02%  importers and exporters of jeans and laptops @yahoo.com @hotmail.com@gmail.com@qq.com@126.com@163.com@aol.com
1          0.02%  importers and exporters of metal scrap in uae@@yahoo.com.ae@gmail.comadvanced search20102011120132009-scam-spam
1          0.02%  importers and exporters of motor spare parts and engines in indonesia and china and india yahoo aol gm
1          0.02%  importers and exporters of textiles 163.com 126.com yeah.net
1          0.02%  importers email address in sudanchad @yahoo @gmail.com @ymail.com @hotmail.com @net @org
1          0.02%  importers of building materials in usa_@yahoo.com @gmail.com @aol.com_hotmail.com_txt
1          0.02%  importers of tyres in thailand@yahoo.com
1          0.02%  importers@abdul@yahoo.com@hotmail.com@mail.fr@emirates.net.ae@web.de
1          0.02%  importers@yahoo.com
1          0.02%  in vitro degradation biocompatibility and physical structure of composite scaffold incorporating bioactive phytomolecule icarii
1          0.02%  in vitro models and development and initial validation of a novel co-culture model for the study of osteoarthritis
1          0.02%  incorporating ptgf-β1/calcium phosphate nanoparticles with fibronectin into 3-dimensional collagen/chitosan scaffolds: efficie
1          0.02%  incorporating ptgf-β1/calcium phosphate nanoparticles with fibronectin into 3-dimensional collagen/chitosan scaffolds: efficie
1          0.02%  incorporating ptgf-β1/calcium phosphate nanoparticles with fibronectin into 3-dimensional collagen/chitosan scaffolds: efficie
1          0.02%  incorporation of osteoblasts (mg63) into 3d nanofibre matrices by simultaneous electrospinning and spraying in bone tissue engi
1          0.02%  inda ke fegar fegar giris pichar ww xxx
1          0.02%  indain 2000@ sex movie
1          0.02%  index email files @yahoo.com @hotmail.com @aol.com @gmail.com @cs.net files
1          0.02%  index inurl intext @yahoo.com list 2013 norway
1          0.02%  indian @pakistan xnxx.com
1          0.02%  indian exporters of agro food products @gmail.com@sify.com
1          0.02%  indian porn videos 3gp @yaho .com download
1          0.02%  indications for non surgical treatment of herniated lumbar disc pdf
1          0.02%  indonesh xxx sexy girlr pic and cartoon sex
1          0.02%  indonesh xxx video
1          0.02%  indonesia @yahoo.co.id women @hotmail.com list emails
1          0.02%  indonesiayahoo.com @aol.com @hotmail.com
1          0.02%  indou @yhoocm.id
1          0.02%  industrial chemicals contact email formic acid
1          0.02%  industrial engineering company managers profles in germany emails and @yahoo.de @hotmail.com gmail.com
1          0.02%  industries mechanizm china 2013 @yahoo.com.cn@yahoo.jp@yahoo.hk@comcast.net. 2013
1          0.02%  influence of nanoscale surface topography mc3t3
1          0.02%  info asses com br
1          0.02%  info aynaprogrami com
1          0.02%  info bioreactors eu
1          0.02%  info cancast ca
1          0.02%  info carbon pl
1          0.02%  info ceramics org
1          0.02%  info cubic ne jp
1          0.02%  info demeter co jp
1          0.02%  info demoustier pt
1          0.02%  info do-fukushima or jp
1          0.02%  info edc ie
1          0.02%  info eksoft com tw
1          0.02%  info ezyeg com
1          0.02%  info genova co jp
1          0.02%  info germ at
1          0.02%  info gtazerbaijan net
1          0.02%  info halewis net
1          0.02%  info handy com vn
1          0.02%  info hyogobcc org
1          0.02%  info kch pl
1          0.02%  info lto org gr
1          0.02%  info mssa jp
1          0.02%  info new-caledonia co kr
1          0.02%  info oilandgas co kr
1          0.02%  info pereira cl
1          0.02%  info ponti pl
1          0.02%  info psp org kh
1          0.02%  info rac ac uk
1          0.02%  info scitel com cn
1          0.02%  info stevej co nz
1          0.02%  info trj pt
1          0.02%  info venezuela org pa
1          0.02%  info@solarman.net.au
1          0.02%  inporter records @yahoo @att @aol filetype txt 2013
1          0.02%  integra mozaik clinical
1          0.02%  international harvester company contactos de correo electrónico hotmail gmail yahoo.com.mx
1          0.02%  international trade exhibitor list 2013 singapore @yahoo @hotmail @gmail
1          0.02%  intext more @yahoo @gmail in facebook
1          0.02%  intext:/ alibaba @yahoo.cn @yahoo.com .txt
1          0.02%  intext:@gmail.comfiletype:txt
1          0.02%  intext:@ymail.com|@gmail.com|@hotmail.com|@yahoo. co.id ext txt facebook
1          0.02%  intext:sympatico.ca filetype.txt
1          0.02%  intext@ymail.com/@gmail.com/@hotmail.com/@yahoo.co.idaxttxtfacebook
1          0.02%  intext:led buyer@
1          0.02%  intitle index.of video sxs top
1          0.02%  intitle: index of 'www.swiftng.com'
1          0.02%  intitle:martha @live.com @yahoo.com -intitle:2013 -intitle:august
1          0.02%  inurl: guestbook site:narod.yandex.ru/
1          0.02%  inurl: led buyers @yahoo.com @yahoo.is %@hotmail.com %@mail.is co.ltd 2013
1          0.02%  inurl: led suppliers %@yahoo.ca %@hotmail.com %@mail.ca co.ltd 2013
1          0.02%  inurl: strap ons forum intext: powered by smf
1          0.02%  inurl: ranch equipment distributor email
1          0.02%  inusayah xxx
1          0.02%  investgation of cell-to-cell interactions
1          0.02%  investment companies directory annabel @prodigy @msn
1          0.02%  ip30.89.152.5
1          0.02%  ir cut importer@yahoo.com
1          0.02%  iraq bajdad xxx
1          0.02%  iraq compnies@yahoo.com@gmail.com@hotmail.com
1          0.02%  irina @mail.ru @hotmail.com txt
1          0.02%  iron sheet manufacturing import
1          0.02%  iron wire @dnet.net.id
1          0.02%  iron wire @fastmail.fm
1          0.02%  iron wire @tm.net.my
1          0.02%  iron wire @yahoo.co.kr
1          0.02%  iron wire omantel.net.om
1          0.02%  is cement considered ceramic
1          0.02%  is surgery best option for degenerative disc d
1          0.02%  iskender@yahoo.com@aol.com @gmail.com @att.net @homail.com
1          0.02%  ismail al 973@batelco.com.bh 2013
1          0.02%  israel dr. @yahoo.com @btinternet.com @yahoo.ca @yahoo.de
1          0.02%  israil mohamad hardsexx
1          0.02%  italy motocycle manufacturer @yahoo.co.cn @gmail.com @hotmail.com @qq.com @aol.com @126.com @16
1          0.02%  j @yahoo.com @gmail.com @hotmail.com 'txt'
1          0.02%  jabbarkhan999@gmail.com
1          0.02%  jaber elec 91@ com
1          0.02%  jack@hotmail.com@gmail.com@yahoo.com@oal.com
1          0.02%  jacqueline@yahoo.com@hotmail.com@gmail.com@aol.com@sbcglobal.net txt
1          0.02%  jame@cox.net 2013
1          0.02%  james @aol.com @yahoo.com @hotmail.com txt
1          0.02%  james @mit.edu txt 2013
1          0.02%  james@aol.comtxt company
1          0.02%  james@hotmail @gamil @ymail @yahoo @mail.com
1          0.02%  james@yahoo.com cn@yahoo.com tw@hotmail.com@gmail.com@126.com@163.com
1          0.02%  james@yahoo.com@hotmail.com@aol.com@gmail.com@juno.com txt
1          0.02%  james@yahoo.com@hotmail.com@outlook.com@gmail.com@yahoo.co.uk@aol.com@bellsouth.net@comcast.net@sbcglobal.net txt 2013
1          0.02%  jamie @hotmail.uk
1          0.02%  jamie @yahoo.com @aol.com @comcast.com @googlemail.com txt
1          0.02%  jane@shaw.ca txt 2012
1          0.02%  japan @hotmail.com @126.com @163.com txt
1          0.02%  japan and korea selling machinery heavy duty equipments 81@gmail@yahoo.uk@ymail@hotmail@yahoo.in@yahoo.ur@yahoo.dr@yahoo.co.uk
1          0.02%  japan business email@aol.com@yahoo.com@gmail.com@hotmail.com
1          0.02%  japan companies email@gmail.com@yahoo.co.jp@aol.com@yahoo.co.br........txtx
1          0.02%  japan e-mail leads 2013@yahoo.co.jp@gmail.com@aol.com
1          0.02%  japan enterprise management directory 2013 @yahoo.com.jp @yahoo.com.kr@hotmail.com.jp@comcast.com.jp@txt
1          0.02%  japan suppliers and manufactures email @yahoo @gmail @hotmail @126 filetype xls
1          0.02%  japan suppliers pvt ltd 2013@yahoo.com hotmail.com @live.com
1          0.02%  japan@yahoo.com@hotmail.com@gmail.com@aol.com 2013
1          0.02%  japanese @yahoo.com @hotmail.com @gmail.com
1          0.02%  japanese american dentals yuan 2013@aol.com
1          0.02%  japanese exporters of marble tiles @gmail.com@hotmail.com
1          0.02%  jarkata man medicine healer
1          0.02%  javedyahoo@uk
1          0.02%  jay @yahoo.com @hotmail.co.kr @at.or.kr @aol.com 2013 txt
1          0.02%  jayden @@@ yahoo.com hotmail.com gmail.com
1          0.02%  jean @aol.com @yahoo.com @gmail.com @hotmail.com txt 2012 2013
1          0.02%  jean sean gmx.ch hotmail.com fax:41 xls
1          0.02%  jean@yahoo.com@aol.com@gmail.com@hotmail.com@sbcglobal.net@att.net txt txt txt txt 2012
1          0.02%  jebus @gmail.com @hotmail.com in swizerland 2014
1          0.02%  jectos cranioplasty
1          0.02%  jectos patent
1          0.02%  jeffrey @aol.com@yahoo.comgmail.comhotmail.com txt 2013
1          0.02%  jemichina@yahoo.com
1          0.02%  jennifer gysin
1          0.02%  jennifer yahoo.com.au // 2012 // 2013
1          0.02%  jennifer@hotmail.com@aol.com@att.net@yahoo.com@cox.net@live.com@gmail.com
1          0.02%  jenny download txt. @aol.com @yahoo.com -scam
1          0.02%  jenny gamil.com@yahoo.co.uk@yahoo.co.cn@yahoo.co.dkyahoo.comyahoo.fr@aol.commsn.comatt.com@hotma.com@comcast.com
1          0.02%  jeo @gmx.de@hotmail.mx@aol.com@yahoo.com.au txt
1          0.02%  jeremiah@gmail.com@yahoo.com@hotmail.com@att.net@sbcglobal.net txt txt txt txt txt 2013
1          0.02%  jerry txt @aol.com@gmail.com@msn.com 2013
1          0.02%  jerry yahoo.com hotmail.com aol.com .txt
1          0.02%  jerry_johnson1401@yahoo.com
1          0.02%  jessica @yahoo.com @gmail.com @hotmail.com txt
1          0.02%  jessica gh 2011 hotgl -bÑvÑÑlbvcbnb
1          0.02%  jessica@gmail.com@yahoo.@hotmail
1          0.02%  jesus 1 @hotmail.es @sbcglobal.net 2013 txt
1          0.02%  jewellery importer exportersmanufacturerdealers in india @yahoohotmailgmail.com
1          0.02%  jewelrys company@yahoo @yahoo.fr @yahoo.ca @yahoo.se
1          0.02%  jiang @yahoo.com.tw airport equipments suppliers in taiwan xls
1          0.02%  jim taylor @aol.com @gmail.com @yahoo.com 2013 txt
1          0.02%  joan @hotmail.com @gmail.com @aol.com @yahoo.com 2013 emailleads .txt
1          0.02%  joan@yahoo.es @hotmail.es txt
1          0.02%  joana @yahoo.com 2013
1          0.02%  joel@yahoo.com@gmail.com@aol.com txt 2013
1          0.02%  johab @comcast.com@aol.com@hotmail.com@yahoo.com 2013text
1          0.02%  johann @gmail.com @yahoo.com email list .txt
1          0.02%  johann @hotmail.com @live.se email list .txt
1          0.02%  john 2013 in europe @bol.com.br@mail.com@inbox.com@gmail.com@hotmail.com
1          0.02%  john @gmail.com@sbcglobal.net@yahoo.com@hotmail.com
1          0.02%  john @hotmail.com @yahoo.com @yahoomail.com @mail.com @yahoo.co.jp @sbcglobal.com @sbcglobal.net 2013
1          0.02%  john @ymail.com@hotmail.com@gmail.com
1          0.02%  john email @yahoo.com txt 2013\
1          0.02%  john fax 52 @gmail.com @hotmail.com@yahoo.com@livemail.com 2011/2012/2013
1          0.02%  john hopkins and electrical bone stimulation
1          0.02%  john@aol.com america list james@yahoo.com @roy.hotmail.com @txt 2013
1          0.02%  john@gmail.com exporter germany
1          0.02%  john@gmail.com txt 2013
1          0.02%  john@hotmail.com.uk @yahoo.com.uk @gmail.com
1          0.02%  john@yahoo.com @gmail.com @hotmail.com @aol.com @live.com txt 2013
1          0.02%  john@yahoo.com @ymail.com @sbcglobal.net @rocketmail.com
1          0.02%  john@yahoo.com.au txt 2011
1          0.02%  johnny cash @aol.ca @hotmail.ca @comcast.net canada text
1          0.02%  johnpaul verizon.com yahoo.com excite.com myway.com 2012 guestboo
1          0.02%  johnson_.yahoomail.com@gmail.com@htomail.com@aol.com
1          0.02%  joint interzone pdgf
1          0.02%  jon @aol.com @net
1          0.02%  jonathan@hotmail.com lovline@aol.com
1          0.02%  jonathan@yahoo.com @hotmail.com @gmail.com @juno.com @aol.com @sbcglonal.net txt
1          0.02%  jones@gmail.com@hotmail.com@yahoo.com
1          0.02%  jonhson kery @yahoo. com
1          0.02%  jonny@rocketmail.com jonny@yahoo.com jonny@gmail.com jonny@hotmail.com jonny@aol.com cvs
1          0.02%  jorge da silva alves. @facebook .hotmail
1          0.02%  jose valter 81@ gmail.com
1          0.02%  jose@gmail.compasword
1          0.02%  josef @bluewin.ch @yahoo.ch @gmx.ch @live.ch @hotmail.ch @gmail.com @aol.com 2013
1          0.02%  joseph yahoo com hk aol com sbcglobal net msn com hotmail com email address
1          0.02%  josephine phillip@yahoo.com
1          0.02%  journal about fractured bones
1          0.02%  journal ecms
1          0.02%  journal material impact factor panama
1          0.02%  journal of e cells materials
1          0.02%  journal of european cells and materials impact factor
1          0.02%  journals on the primary immune system
1          0.02%  joyce @gmail.com @yahoo.com @hotmail.com @aol.com txt
1          0.02%  joycegodwin01 @ ya hoo . in
1          0.02%  joycelyn@yahoo.com@hotmail.com@gmail.com@ail.com txt 2012
1          0.02%  jpg4.us susan dey
1          0.02%  juan@hotmail.com @gmail.com @yahoo.com txt
1          0.02%  jude@yahoomail.com@hotmail.com@gmail.com@aol.com 2012/2013 nxt
1          0.02%  judy @gmail.com @yahoo.com txt/2013
1          0.02%  juerg gasser novartis
1          0.02%  juerg gasser novartis basel
1          0.02%  justin @yahoo.comyahoo.cayahoo.uk 2012 leads
1          0.02%  kais @gmail.com@aol.com@yahoo.com :xls
1          0.02%  kaka.du 777@hotmail.com
1          0.02%  karan @gmail.com @yahoo.co.in @rediffmail.com 2012/2013 txt
1          0.02%  karl 2012 22 @hotmaol . c
1          0.02%  kate % @aol.com @hotmail.com % @gmail.com % @yahoo.com % @fuse.net % @sbcglobal.net txt 2013
1          0.02%  katesex wap.net
1          0.02%  keezmovi.org
1          0.02%  kelly@gmail @ymail @hotmail @mail
1          0.02%  kelvin@yahoo.com@gamil.com@hotmail.com2013
1          0.02%  ken@yahoo.com mark@hotmail.com dav@gmail.comjeo@sify.com2010
1          0.02%  kenapa setingan akun imail blackberry tidak ada yaho gimail dan yang lainnya
1          0.02%  kendy @s yaa coom
1          0.02%  keto sexarb syria
1          0.02%  keto sexمع حيوانات
1          0.02%  ketosex أوربي/
1          0.02%  key words: menisci tibial; knee injuries; tissue engineering; review
1          0.02%  khaled@maktoob.com txt
1          0.02%  khan 2013@gmail.com--webmaster--postmaster--scam--419 xxx
1          0.02%  kids wear supplier in china @live.com @msn.com @hotmail.com yahoo ymail
1          0.02%  kim @yahoo.com@gmail.com@hotmail.com
1          0.02%  kimmy@yahoo.com@hot mail.com@gmail.com@aol.com
1          0.02%  kistan @yahoo.comgmail.com@aol.com@hotmail.com@msn.com 2013
1          0.02%  kitchen_importer@yahoo.
1          0.02%  kleenealon@gmx.de
1          0.02%  klein benutzername und passwort@arcor.de@yahoo.de@web.de@freenet.de@hotmail.de 11 august 2013
1          0.02%  kmu pk cgi sys defaultwebpage
1          0.02%  knee cartilage repair
1          0.02%  koch@yahoo.de @aol.com @ymail.de @gmx.de @hotmail.de @freenet.de 2013
1          0.02%  kodi eng-fra pour samsung gt-b7300
1          0.02%  kong @telus.net txt
1          0.02%  korent xnxx hot movie .com
1          0.02%  kredit gesucht @gmx.net @bluewin.ch
1          0.02%  ku guestbook 2013 @yahoo
1          0.02%  kumar @yahoo.com @gmail.com @hotmail.com 2013txt
1          0.02%  kumar @yahoo.in @gmail.in @rediffmail.com -
1          0.02%  kuwait business men @hotmail.com @gmail.com.kw
1          0.02%  kuwait chemical manufacturing company@hotmail.com@gmail.com@yahoo.com
1          0.02%  kuwait email@gmail@emiratesyahoo@vsnl@163.au needed
1          0.02%  kuwait korea china hong kong spain @yahoo.com @btinternet.com @hotmail.com @globalsbc.com
1          0.02%  kuwait list of trade members@yahoo.com filetypetxt
1          0.02%  kuwait pron sex fucking iraniya videos
1          0.02%  kuwait's@yahoo.com@hot mail.com@gmail.com@aol.com
1          0.02%  kuwait@yahoo.com@gmail.com@hotmail.com in 2013 - scam
1          0.02%  kyikpaul@yahoo.com
1          0.02%  köpege am yayatan kız pornosu
1          0.02%  l.g. harris european cells and materials vol. 4. 2002 (pages 39-60)
1          0.02%  l.l.c export/import @eim.ae @emirates.net.ae @hotmail.com
1          0.02%  labourers @hotmail.com @yahoo.com @gmail.com filetype: txt
1          0.02%  ladia@yahoo.com@gmail.com@hotmail.com txt
1          0.02%  large tissue engineering problem
1          0.02%  larry % @verizon.net @bellsouth.net @msn.com %2012\2013 txt
1          0.02%  latest @ymail @gmail @hotmail 2013 :txt
1          0.02%  lauer@sbcglobal.net @comcast.net @bigpond.com @bellsouth.net @netzero.net 2013
1          0.02%  laura yahoo.co.nl
1          0.02%  lawal@yahoo.com in nigeria
1          0.02%  ldpe buyer@hotmail.com
1          0.02%  led mail.ca file.xls
1          0.02%  led tube
1          0.02%  lee @at.or.kr @yahoo.com.tw txt.2013
1          0.02%  lee @hotmail.com.cn @gmail.com.cn @comcast.net.cn 2013 japan
1          0.02%  lee guestbook @yahoo.com @gmail.com @live.com
1          0.02%  lee....................@yahoo.com.................@hotmail.com............@aol.com...........@gmail.com
1          0.02%  lee@yahoo.cn@yahoo.es@yahoo.fr@gmail.com@126.net@sina.com@qq.com/2013
1          0.02%  leucine bone structure
1          0.02%  lg t375 baixar moodleid
1          0.02%  li gmail.com hotmail.com aol.com qq.com
1          0.02%  licia @cs.com 2013 -scam -email
1          0.02%  lie@yahoo.com @gmail.com @hotmail.com alibaba
1          0.02%  light @aol @comcast @hotmail @gmail @yahoo
1          0.02%  lil@ukr.net @gmail.com @aol.com 2013
1          0.02%  lilian@hotmail.co.za txt 2013
1          0.02%  limitations of animal studies in bone
1          0.02%  lin@yahoo.com@gmail.com@hotmail.com@aol.com@live.com txt
1          0.02%  linda chung 1234 @hotmail. com
1          0.02%  linda@saimage.co.za @mweb.co.za @yahoo.co.za 27 -2013_8
1          0.02%  link.nokia.com/redir/youtube/sمقاطع‏ ‏بنات‏ ‏عرب‏ ‏نار
1          0.02%  link.nokia.comكس/redir/youtube/s
1          0.02%  linsa lee @yahoo.cn @hotmail.com @live.com @juno.con @bellsouth.net 2013
1          0.02%  lisa@gmail.com @hotmail 45 or live ca -2013 update-hoax
1          0.02%  list malaysia @comcast.net @gmail.com @sbcglobal.net @hotmail.com @earthlink.net @yahoo.com
1          0.02%  list member toyota@yahoo.com @yahoo.com @hotmail.com
1          0.02%  list of importer in china @gmail.com
1          0.02%  list of importer in china @yahoomail.com
1          0.02%  list of importers and exporters in south africa @gamil.com
1          0.02%  list of importers in qatar @gmail.com
1          0.02%  list of producer in texas @aol.com @yahoo.com @gmail.com @hotmail.com
1          0.02%  list of qatar engineers emails @yahoo.com @hotmail.com
1          0.02%  list porfile people email@yahoo @gmail.com
1          0.02%  liu@yahoo.com @hotmail.com @gmail.com @aol.comtxt
1          0.02%  ljlapin@bellsouth.net
1          0.02%  loan seeker in greek @yahoo @hotmail / txt/
1          0.02%  loan seeker india @gmail.com @rediffmail.com txt 2013
1          0.02%  loan seekers 2013 @aol.com @gmail.com @hotmail.com txt
1          0.02%  loan urgent needed @ mail.com @ mail.ru @ gmail.com @ yahoo.com @ hotmail.com 2013
1          0.02%  login.ezlibproxy.unisa.edu.au hack
1          0.02%  long term follow up bovine pericardium patch
1          0.02%  lopes rajesh19gmail.com
1          0.02%  lopez @mweb.com.na or @hatch.co.za 27 -2013
1          0.02%  louis @aol.fr [xls] @gmail.fr @yahoo.fr
1          0.02%  louis@hotmail.com@ymail.com@yahoo.com@gmail.com 2013
1          0.02%  ltd 966 @gmail.com 2013
1          0.02%  ltd @yahoo.in or @yahoo.comexporters/importers
1          0.02%  lucan @outlook es paulina 1970
1          0.02%  lucas @hotmail.com@aol.com@mail.ru @cox.net@gmail.com @juno.com 2013 txt
1          0.02%  lucas @yaho.com @yahoo.co.uk @att.net @sbcglobal.net - oil and-gas
1          0.02%  luck@aol.com @gmail.com @net.com
1          0.02%  luis benutzername und passwort@arcor.de 2013
1          0.02%  luis@rocketmail.com luis@yahoo.com luis@gmail.com luis@hotmail.com luis@aol.com cvs
1          0.02%  luxembourgmanufacturers @yahoo.com @aol.com @ymail.com domain email @hotmail.com @gmail.com 2013
1          0.02%  lynn@gmail.com@hotmail.com@aol.com@sbcglobal.net@yahoo.es
1          0.02%  m porn free
1          0.02%  m-hassen @yahoo.de @gmail.com @hotmail.com
1          0.02%  m.beemp3.com/index.phpst=all
1          0.02%  m.escapemobile.com/tw wap/ldp/ldp.html id=26934
1          0.02%  m.pornhub .com vero
1          0.02%  m.www.indian sexgilis.com
1          0.02%  m.xnxx.‎عربيcom
1          0.02%  m.youtube.com/client=mv-nokiawww sex photo hot com
1          0.02%  m/mclient=ms-nokia
1          0.02%  ma.faramarzi
1          0.02%  mable@yahoo.co.za @gmail.co.za @hotmail.co.za txt
1          0.02%  mables
1          0.02%  machinery buyers@yahoo.com @gmail.com @hotmail.com @rediffmail.com
1          0.02%  machinery importersexpotersmanufacturerdealers in hungary@hotmailyahoogmail.com
1          0.02%  macopharma microleakage
1          0.02%  macrophages in the vascularization of engineered tissues
1          0.02%  madeinchina.@yahoo.com.@hotmail.com.@gmail.com
1          0.02%  magdalena ik ben van nederlands ik moet dringend loan@live.nl
1          0.02%  magdalena ik moet dringend loan@live.nl @ hotmail.nl @ yahoo.nl
1          0.02%  magnesium phosphate cements mix design
1          0.02%  magnetic fields for bone regeneration
1          0.02%  mahmood mohamed284@yahoo.com
1          0.02%  mail contact of mrs and mr 001yahoo.co.in usa 2013
1          0.02%  mail list of canadian pentecostal churches@yahoo@gmail@hotmail@centrum
1          0.02%  mail yahoo hotmail gmail msn outlook ext txt
1          0.02%  mail yahoo hotmail gmail oi ig bol live ext txt
1          0.02%  mail yahoo hotmail gmail oi ig bol live ext txt 2013
1          0.02%  mail.com @yeah.net @sina.com txt 2013
1          0.02%  mailto:led high bay light pakistan pa
1          0.02%  major exporters and importers of thp-10 candy tablet press 163.com 126.com yeah.net
1          0.02%  malaysia machinery dealers with china @yahoo.com @gmail.com @hotmail.com
1          0.02%  malaysia manifactureresstock dealers managersceochairmans emails contact @yahoo.com.@hotmail.com.@gmail.com.@comcast.com.@rocke
1          0.02%  malaysia minister current @hotmail@yahoo@ymail
1          0.02%  malaysia oil@yahoo.com.my email fax in xsl 2013
1          0.02%  malaysian dealer of building materials@yahoo.com.@hotmail.com.@gmail.com
1          0.02%  malaysian real estate 4shared.com samuel@gmail.com @yahoo.com.my @hotmail.com.my
1          0.02%  malcolm @hotmail.com
1          0.02%  malissa 49@ live.co.uk
1          0.02%  mama 505 hotmail@
1          0.02%  mamma.yahoohotmailntt.com@gamil.com2013
1          0.02%  management
1          0.02%  manager giri nepal' live.com att.nt live.com hotmail.it hotmail.de hotmail.th hotmail.es msn.com hotmail.fr live.com hotmail.it
1          0.02%  managers and directors email address in europetxt 2012/13
1          0.02%  managers@yahoo.com.bh @ hotmail.com @ gmail.com @ @ live.com cs.com
1          0.02%  mandy wong 01@gmail
1          0.02%  mansonthomson@yahoo.com
1          0.02%  manufactrurer's emails 2013: cvs file @sina.com @126.com @qq.com
1          0.02%  manufacturals companys businesses dealers contacts in asia @hotmail.com @gmail.com @mail.com
1          0.02%  manufacture furnitures china sales@*.cn
1          0.02%  manufacture of construction materials mr paul tel 41 bluwin.ch
1          0.02%  manufacture-companies in china 86 gmail.com 2013
1          0.02%  manufacturer @163.com @qq.com @126.com @sohu.com @sina.com txt
1          0.02%  manufacturer and buyers of garment @yahoo
1          0.02%  manufacturer and importing and companies in kuwait their yahoo hotmail gmail
1          0.02%  manufacturer association of korea 2013 @gmail.com @sify.com @yahoo.com
1          0.02%  manufacturer in hong kong@gmail@yahoo@hotmail.com
1          0.02%  manufacturer of sea foods dealers supplies importers xporters @yahoo.com @hotmail.com@gmail.com
1          0.02%  manufacturers and sellers of clothes in russia @yahoo.com @hotmail.com @gmail.com @163.com @126.com
1          0.02%  manufacturers dealers suppliers importers exporters email @yahoo.com@hotmail
1          0.02%  manufacturers in america @ yahoo msn live hotmail 123 163 gmail txt 2012
1          0.02%  manufacturers in australia@yahoo@hotmail@gmail.com
1          0.02%  manufacturers of all metal good in belgium @yahoo @hotmail @gmail @aol 2013
1          0.02%  manufacturers of copper wire in china @alibaba xls
1          0.02%  manufacturers of copper wire in taiwan @yahoo.com.tw xlm
1          0.02%  manufacturers of generators in qatar 2013@gmail.com@hoymail.com
1          0.02%  manufacturers of track in germany email @gmail.com @yahoo.co.de @hotmail.com @rediffmail.com filetype: xls filetype: doc filety
1          0.02%  manufacturers of transportation equipment in us email @gmail.com @yahoo.com @hotmail.com @163.com @126.m @qq.com filetype:xls o
1          0.02%  manufacturers sellers buyers in china @126.com @163.com @yahoo.cn @gmail.com @hotmail.com txt
1          0.02%  manufacturers suppliers exporters importers buyers wholesalers of sea foods @yahoo.com @hotmail.com and @gmail.com in any speci
1          0.02%  manufacturers suppliers producers agents importers exporters in singapore @hotmail.com @yahoo.com.sg @singnet.com.sg
1          0.02%  manufacturers-suppliers-exporters of cosmetic
1          0.02%  manufactures of industrial products @yahoo.com@hotmail.com@126.com@163.com@msa.hinet.net@yahoo.com.pk@yahoo.it@yahoo.com.tw
1          0.02%  manufactures of textiles @yahoo.com@hotmail.com@126.com@163.com@msa.hinet.net@yahoo.com.pk@yahoo.it@yahoo.com.tw
1          0.02%  manufacturesexporters and importers @yahoo@hotmail.com in finland 2013 txt
1          0.02%  manufacturing and distributors of hospitals equipments 2013@hotmail.com .cn
1          0.02%  manufacturing and supplier buyers emails addresses in thailand @yahoo.com
1          0.02%  manufacturing companies email yahoo.com.cn
1          0.02%  manufacturing companies in asia @yahoo.com @gmail.com @hotmail.com
1          0.02%  manufacturing importers of generators in china @alibaba.com@gmail.com@163.com@126.com@qq.com@hotmail.com@yahoo.com
1          0.02%  mara @gmail.com @yahoo.com @hotmail.com @aol.com @rocketmail
1          0.02%  marble company@yahoo @yahoo.fr @yahoo.ca @yahoo.se
1          0.02%  marbles manufacturers sellers company malaga phone fax email@yahoo.com
1          0.02%  maria @hotmail.com @yahoo.com @gmail.com @aol.com txt 2013
1          0.02%  maria garcia @yahoo.com.br @gmail.com @hotmail.com 2013
1          0.02%  maria@yahoo.com @gmail.com @hotmail.com @live.com txt ~~~~ % 2013
1          0.02%  mariaana @yahoo.es
1          0.02%  mariah @yahoo.uk@gmail.com@hotmail.com@aol.com@msn.com@yahoo.com@yahoo.us txt 2013
1          0.02%  mariah@gmail.ru @hotmail.ru @yahoo.ru@aol.ru 2013 txt
1          0.02%  mariam abou 88 @hot mail.com.
1          0.02%  marine workers union@hotmail@gmail@aol@yahoomail
1          0.02%  mark @@@ @yahoo.com @hotmail.com @mail.com @live.com @gmail.com txt 2012
1          0.02%  mark @live.com@gmail.com@shaw.ca@aol.com txt 2013
1          0.02%  mark @yahoo.com @hotmail.com txt 2013
1          0.02%  mark@gmail @ymail @hotmail @mails. com
1          0.02%  mark@gmail.com@yahoo.com
1          0.02%  mark@yahoo.de@yahoo.ca@yahoo.com@hotmail.com@gmail.com .txt
1          0.02%  marko@sbcglobal.net@yahoo.com@ok.net@gmail.com 2014
1          0.02%  markus benutzername und passwort@arcor.de 2013
1          0.02%  marry harry f@hotgamil.com
1          0.02%  marther@yahoo.com@gmail.com@aol.com@att.net@hotmail.com
1          0.02%  marticom firmware mx2
1          0.02%  martin@yahoo.com @hotmail.com @live.com @gmail.com txt
1          0.02%  marufa mypornwap.com
1          0.02%  mary @aol.com txt 2013
1          0.02%  mary @comcast.com @hotmail.com @gmail.com @yahoo.com
1          0.02%  mary-graça 81@ hotmail.com
1          0.02%  mashalnavy.ng
1          0.02%  material properties porcine bone
1          0.02%  mathematical model articular cartilage repair
1          0.02%  maxco compine girls pic
1          0.02%  maximiliano@yahoo.com@hotmail.com 2013 txt
1          0.02%  maximiliano@yahoo.com@hotmail.com@gmail.com@msn.com@aol.com
1          0.02%  maxy @yahoo.com @hotmail.com 2013 txt
1          0.02%  maz rendy 66@ gmail com
1          0.02%  mbox50
1          0.02%  mechancal strength bone fracture
1          0.02%  mechanical behaviour of chondrocytes on scaffold
1          0.02%  mechanical stimulation electrical stimulation
1          0.02%  mechanotransduction scaffold msc cell measure osteo
1          0.02%  medel@yahoo.com@hotmail.com@sbcglobal.net@aol.com txt
1          0.02%  medical and biological applications of carbon nanotubes
1          0.02%  medical application of carbon nanotubes
1          0.02%  medical application of cnt
1          0.02%  medical applications of carbon nanotube
1          0.02%  medicinal applications of cnts
1          0.02%  medicinal use of carbon
1          0.02%  medicos gmail com or uol com br or hotmail com or ig com br or globo com filetype txt
1          0.02%  medlib mercer ezproxy
1          0.02%  megz @hotmail.com@gmail.com@ymail.com@aol.com @yahoo.com -2013
1          0.02%  melissa gm @hot mail.com
1          0.02%  member @hotmail.gr @mail.gr @otenet.gr @yahoo.gr
1          0.02%  member directory of contractor association in european @aol.uk@aol.de @gmail.fr@hotmail.fr yahoo.fr 2012 2013
1          0.02%  members @yahoo.co.id indonesia @gmail.com 62
1          0.02%  members of construction in tunisie tunisie @yahoo.com @yahoo.fr @gmail.fr @gmail.com @live.fr @livemail.fr @hotmail.fr @hotmail
1          0.02%  members of direactors in saudi arabia 2013 @hotmail.com
1          0.02%  members@yahoo.com
1          0.02%  mena mona 48@ yahoo.com
1          0.02%  mensen die dringende lening in nederland@yahoo.nl @ live.net nodig 2013
1          0.02%  mer @cox.net @azhotmail.com @earthlink.net @hotmail.com @cableone.net @yahoo.com joy txt
1          0.02%  mercury importers@twcny.rr.com
1          0.02%  mercury importers@verizon.net
1          0.02%  mercurybuyers@comcast.net
1          0.02%  mercy johonsin pron
1          0.02%  mercy marro@aol@hotmail@gmail@yahoo.com 2013 usa txt
1          0.02%  mesenchymal spheroid
1          0.02%  mesenchymal stem cell niche coculture expand
1          0.02%  mesenchymal stem cells therapy
1          0.02%  mesene @hotmaol
1          0.02%  metal dealers in india @aol.com@yahoo.com@gmail .com@hotmail.com guest book2013
1          0.02%  metal suppliers@yahoo.hk xls
1          0.02%  methods for cartilage replacement pdf
1          0.02%  methods of cytotoxic evaluation
1          0.02%  metscope f24 dedektör
1          0.02%  meyer @hotmail.com @yahoo.com @bellsouth.net @verizon.net @cox.net 2009 2013 2 22 22 111111111111111111111
1          0.02%  meyer-lindenberg angiogenese
1          0.02%  mice cartilage young adult
1          0.02%  michael % @yahoo.co.uk' @aol.com' @gmail.ca' %2012\2013 txt
1          0.02%  michael.samo180@bluewin.ch
1          0.02%  michael@yahoo.co.uk michael@hotmail.com.ca michael@gmail.com csv michael@aol.com
1          0.02%  michell@yahoomail.ca @aol.com @gmail.com @mail.com email txt 2013----scam mails
1          0.02%  michelle @earthlink.net text 2013
1          0.02%  microfabrication of fractal polymeric structures for capillary morphogenesis: applications in therapeutic angiogenesis and in t
1          0.02%  middle east email database for all business owners @hotmail.com@gmail.com@msn.com
1          0.02%  middle east importers and expoters desiel china oil @yahoo 2013 alibaba
1          0.02%  middle east steel pipe distributor @email
1          0.02%  middle east txt 2013 @aol.com @gmail.com @ yahoo.com @comcast.net middle east 2013 txt
1          0.02%  middle east txt 2014 @yahoo.com@aol.com @hotmail.com txt middle east txt 2014
1          0.02%  middle east wholesale pipe suppliers @hotmail.com @yahoo.com @gmail.com
1          0.02%  middle eastern contractors email address /guestbook 2013 @yahoo.com@hotmail.com
1          0.02%  mike @mpikg.mpg.de
1          0.02%  mike@gmail.com.com txt 2013
1          0.02%  mikel@gmail.com@yahoo.com
1          0.02%  military vehicle sales imports exports @yahoo @hotmail @gmail
1          0.02%  military@gmail.comymail.comaol.com.ukhotmail.com.live.comtxt2013
1          0.02%  milking equipment @gionline.com.au
1          0.02%  miller @yahoo.com @aol.com @hotmail.com gmail.com usa 2013 txt
1          0.02%  miller@yahoo.com@gmail.com@hotmail.com@juno.com@sbcglobal.net@yahoo.co.uk@hotmail.co.uk@msn.com@fastmail.com@gmail.co.uk
1          0.02%  mills yahoo.comhotmail.comgmail.comfiletype 2013
1          0.02%  ming@yahoo gmail hotmail comcast msn aol org ca jp.tw.my.com ming@yahoo gmail hotmail comcast msn aol org ca jp.tw.my.com -scam
1          0.02%  ministers in uganda 2013 @hotmail @yahoo @ymail
1          0.02%  ministers in uganda @hotmail @yahoo @ymail
1          0.02%  ministers kuwait current email @hotmail @ymail@yahoo@gmail
1          0.02%  ministry of natural @yahoo email list participants
1          0.02%  miriambaby2011@hotmail.co.uk
1          0.02%  mitchell@yahoo.com.uk mitchell@rocketmail.com.ca mitchell@hotmail.com.hkmitchell@gmail.com.qa mitchell@aol.com csv
1          0.02%  mlki yahoo.com @hotmail.com @att.net @aol.com xtx 2013
1          0.02%  mo163.comyahoo.comsina.com 2013
1          0.02%  mobil companies in asia@yahoo.com@gmsil.com@hotmail.com@4share.net@craigslist.com
1          0.02%  mobile phone importers @sinos.net
1          0.02%  modeling . uk petra@gmail.com
1          0.02%  modeling of peptide binding to polar surfaces of zno by molecular dynamics simulations
1          0.02%  mohamad guestbook @yahoo.com.my txt
1          0.02%  mohamed @gmail.com @yahoo.com @hotmail.com pakistan 2012/2013 txt
1          0.02%  mohamed284.ma
1          0.02%  mohamed@yahoo.com mustafa@yahoo.com @gmail.com @hotmail.com farouk@sa.com txt csv
1          0.02%  mohamed@yahoo.comsa@hotmail.com.sa
1          0.02%  mohammad @yahoo.com @hotmail.com @aol.com @gamil.com 2013
1          0.02%  mohammad fax 92 @gmail @hotmail@yahoo 2012/2013
1          0.02%  mohammad@yahoo.com.sa hotmail.com.sa gmail.com.sa aol.com.sa 2013 txt
1          0.02%  mohammadi.abbas16@yahoo.com.
1          0.02%  mohammed @hotmail.com @comcast.net @aol.com @bellsouth.net txt
1          0.02%  mohammed @yahoo.com @gmail.com @hotmail.com @sbcglobal.net txt
1          0.02%  mohammed @yahoo.com @hotmail.com tx-
1          0.02%  mohammed @yahoo.comgmail.com in saudi arebia 2012/2013
1          0.02%  mohammed iraq email id 2012/2013@yahoo.co.id
1          0.02%  mohammed@hotmail.com@yahoo.com@aol.com@cs.com@gmail.com
1          0.02%  mohammed@msn.com@hotmail.fr@yahoo.in@aol.net/2013
1          0.02%  mohammed@yahoo.com.kw @hotmail.com.kw
1          0.02%  mohammed@yahoo.com@gmail.com@hotmail.com@sbcglobal.net@aol.com@earthlink.net
1          0.02%  mohamoud saudi arabia kuwait @yahoo.com hotmail.com: filetype.txt 2013
1          0.02%  mohd yahoo.com hotmail.com gmail.com mail.com/2012
1          0.02%  mona india @ahoo com
1          0.02%  money exchangers abu dhabi @emirates.ae@yahoo.com@gmail.com@126.com@hotmail.com
1          0.02%  moores@yahoo.com.mx@gmail.com.mx@aol.com.mx@ymail.com.mx/txt/2013
1          0.02%  morgan@hotmail.com@ymail.com@comcast.com txt
1          0.02%  morison@yahoo.com@hotmail.comtxt
1          0.02%  morris @mweb.com.na or @hatch.co.za or @gmail.co.za 27 -2013
1          0.02%  morrison@yahoo.com@gmail.com@aol.com@hotmail.com@comcast.com
1          0.02%  motor battery suppliers in china online @hotmail.com @126.com @163.com @yahoo.cn 2013
1          0.02%  motor part co.ltd @163.com @126.com @vip.163.com
1          0.02%  motor spare parts @yahoo.com.cn @gmail.com @hotmail.com @163.com
1          0.02%  motorcycle spare parts manufacturers in china @126.com @163.com @hotmail.com @yahoo.cn 2013
1          0.02%  mr james@yahoo.comgmail.comhotmail.comtxt
1          0.02%  mr jin @hotmail.com @yahoo.com.hk @gmx.ch @sbcglobal.net txt
1          0.02%  mr williams steel producers in japan @gmail.com
1          0.02%  mr youssef @hotmail.com @yahoo.com.hk @aol.com @live.com.au @gmx.ch txt
1          0.02%  mr. kelly yves @earthlink.net @aol.com @gmail.com @bellsouth.net 2013 txt
1          0.02%  mr.umarsaeed@yahoo.com
1          0.02%  mrizhang@yahoo.ca
1          0.02%  mrs susan @aol.com @163.com @qq.com @gmail.com
1          0.02%  mrs williams @bellsouth.net @sbcglobal.net @verizon.net @aol.com @gmail.com 2012/2013
1          0.02%  mrs. j.j. harvey board of directorshotmail.com @aol.com @gmail.com 2013
1          0.02%  mrsa adhesins overview
1          0.02%  ms@yahoo.com@hotmail.com@bellsouth.net@earthlink.net txt 2011
1          0.02%  msc huvecs vascular
1          0.02%  msc.uk@yahoo.com
1          0.02%  muh myvnc default
1          0.02%  muhamadabdollah@yahoo.com
1          0.02%  muhammed @hotmail.com or @gmail.com or @aol.com or @yahoo.com
1          0.02%  muhmmad.ahmad.420yahoo.com
1          0.02%  mustafa abdallah 91@ yahoo.com
1          0.02%  mustafa@yahoo.au @yahoo.ca @yahoo.com.ph @yahoo.com @gmail.com @att.com @sbcglobal.com @yahoo.pe @yahoo.ru @yahoo.de @yahoo.dk 
1          0.02%  mxx .comh
1          0.02%  my cyber.xtgem.com
1          0.02%  my doctor email address in usa @att.netsbcglobal.netbellsouth.net
1          0.02%  myan.mar.tha.zin.xnxx.cmo.viqeo
1          0.02%  myp0rnwap
1          0.02%  myp0rnwap.
1          0.02%  mystery park swi-
1          0.02%  names and email adresses of men and women from united states in businessceo'sstoke brokerstraderscompany ownersnursedoctors@yah
1          0.02%  names and email of business men and women is usa @yahoo@hotmail@gmail@aol
1          0.02%  names nigeria @gmail @yahoo @rocketmail @live @hotmail
1          0.02%  nancy desmond2013 @ yahoo.com uk
1          0.02%  nanotube drugs
1          0.02%  natalischatz@yahoo
1          0.02%  nathaniel@gmail.com@yahoo.com@hotmail.com@cox.net@sbcglobal.net@att.net txt txt b txt txt
1          0.02%  nelson@gmail txt
1          0.02%  neosmssite@gmail.com
1          0.02%  nepali galrs photo .coom
1          0.02%  nettt vera sex porno
1          0.02%  neurosphere culture
1          0.02%  neurosphere dcx
1          0.02%  nevada %100 project@hotmail.com investor@earthlink.net % funding@aol.com
1          0.02%  new anti-infective coatings of medical implants
1          0.02%  new company in russia 2013 @bol.com.br@uol.com.br@terra.com@yahoo.com@gmail.com@hotmail.com
1          0.02%  new xxx hota0l room me mp4 free download
1          0.02%  newman@yahoo.com.uk newman@hotmail.com.my newman@rocketmail.com.br newman@gmail.com.ca newman@aol.com.hk
1          0.02%  news on nigeria military pensoniers
1          0.02%  nicole @yhaoo.de @freenet.de @web.de @arcor.de-scam-webmaster 2013
1          0.02%  nicole anisote porno.com
1          0.02%  nik arab@ .com
1          0.02%  nil@yahoo.com conrent mails 2013
1          0.02%  nmchristensen@bio.ku.dk
1          0.02%  nms.iiitd.edu.in:9104
1          0.02%  nnnx.comللجوال
1          0.02%  nokia x2-02/2.0(11.84) profile/midp-2.1 configuration/cldc-1.1 untrusted 1.0)
1          0.02%  nonwoven buy @hotmail
1          0.02%  nora @yahoo.ca
1          0.02%  norahnelson2012@yahoo.in
1          0.02%  norway business emails @aol.com @yahoo com@hotmail @gmil .com txt
1          0.02%  norway church panpels.com
1          0.02%  notepad_link_weburl www xvideos com
1          0.02%  nour business directories sellers and exports @yahoo.com @ymail.com
1          0.02%  nu pogodi game n85 free download
1          0.02%  nucleus replacement technologies coric
1          0.02%  nur @hotmail.com @yahoo.com @gmail.com
1          0.02%  nur @singnet.com.sg txt
1          0.02%  nurses 2013 @yahoo.com.au@gmail.com@optusnet.com.au@dodo.com.au txt
1          0.02%  nurses e mail addresses @verizion.net@hotmail.com@shaw.ca@yahoo.ca@it.de
1          0.02%  oil
1          0.02%  oil @yahoo.com.cn
1          0.02%  oil and gas business men in usa manufacturals @ gmail.com aol .com
1          0.02%  oil and gas dealers in china @yahoo.com @hotmail.com @gmail.com
1          0.02%  oil and machinary ltd llcc 971 companies filetype xls
1          0.02%  oil companies guest book in qatar@hotmil.com@sbcglobal.net 2013
1          0.02%  oil company 968contact@ distributors in kuwait 965@yahoo.com%%%
1          0.02%  oil company directors contacts 2013/hotmail and yahoo
1          0.02%  oil company email addres @aol.com@comcast.net@sbcglobal.net@charter.net@yahoo.fr 2013
1          0.02%  oil dealers in texas aol email directory 2013 @aol.com@gmail.com
1          0.02%  oil import car dealers @yahoo.com @yahoo.com
1          0.02%  oil importer and exporter companies email address @yahoo com in australia
1          0.02%  oil merchant in saudi arabia (oil) @yahoo.com @gmail.com @hotmail.com @aol.com
1          0.02%  oil owners email address @ yahoo.com @aol.com @gmail.com @hotmail com 2013
1          0.02%  oli and gas company @yahoo email list participants
1          0.02%  omer abdu@34gmail .com
1          0.02%  ong@gmail@aol@yahoo txt
1          0.02%  online members free email penpal dating site tonga@ hotmail gmail yahoo.com.mx
1          0.02%  online new jugd u site email and rocketmail.co.uk and aol.de
1          0.02%  online today members free email penpal dating site angola@ hotmail gmail yahoo.com.mx
1          0.02%  online today members free email penpal dating site zambia @hotmail gmail yahoo com mx
1          0.02%  open access journal with impact factor 2012 in material science
1          0.02%  openwebmail copyright (c) 2006-2010
1          0.02%  opposite of co-culture
1          0.02%  origami structures,engineering
1          0.02%  orthopedic implants per year
1          0.02%  osca@yahoo.com@hotmail.com@gmail.com@aol.com@earthlink.com@sbcglobal.com@mail.ru@att.net txt
1          0.02%  osman @yahoo.com @hotmail.com @gmail.com
1          0.02%  osteoblast aligment elongation and migration on grooven
1          0.02%  osteoblast differentiation cell culture
1          0.02%  osteoblastic reaction definition
1          0.02%  ovine spine model for human bone
1          0.02%  owa.skm.com.tw/owa
1          0.02%  own company email address @live.cn @qq.com 163.com @126.com @livemail.tw
1          0.02%  p @sbcglobal.net @bellnet.ca .txt @sympatico.ca -
1          0.02%  pac%40bigpond.com %40hotmail.com %40gmail.com aol.net txt
1          0.02%  pakistan @yahoo.com mohammed @hotmail.com members
1          0.02%  pakistan business men in import and export @gmail
1          0.02%  pakistan girl fukid porn gag sex 3gp download
1          0.02%  pakistani vides neat tube porn tub vidoe .c
1          0.02%  pakistani village house@yahoo.com
1          0.02%  pamela @hotmail.com @ hotmail.com txt 2013
1          0.02%  paper buyer@rawagegypt.com
1          0.02%  paper@hotmail.com
1          0.02%  paraffin wax buyer @
1          0.02%  park(212) 999 @yahoo.com@aol.com@gmail.com txt 2013
1          0.02%  park://chang.won http https httpa www
1          0.02%  parker@yahoo.com.ukparker@rocketmail.com.caparker@hotmail.com.hkparker@gmail.com.qaparker@aol.com csv
1          0.02%  part and sellers in 126 com 163 com gmail com yahoo com hotmail com
1          0.02%  partial thickness focal cartilage defect
1          0.02%  passwd.txtsite:org
1          0.02%  password list uol internet
1          0.02%  paul@alice.it user name and password updatetxt2013
1          0.02%  paul@yahoo@gmail@alice.it@hotmail@aol.com@aim@live.com txt 2013
1          0.02%  pauline@comcast.net@aol.com@yahoo.com@hotmail.com for 2010 to 2013 txt
1          0.02%  paulo@hotmil2012
1          0.02%  pediatric bone stimulation use non union
1          0.02%  pedro roa @gmail .cl
1          0.02%  pelet ml 151
1          0.02%  pellet culture chondrocyte differentiation assay
1          0.02%  pemf bone healing
1          0.02%  people selling and buying computer accessories@yahoo.com.cn or @gmail.com or @hotmail
1          0.02%  peoples buying and selling motorcycles spare parts and heavy machine parts accesssories@yahoo.com.cn or gmail.com or hotmail.co
1          0.02%  perpadas sexo gratis porno
1          0.02%  peru's business
1          0.02%  peterson@yahoo.co.uk csv
1          0.02%  petrochemical suppliers and buyers @yahoo.cn @gmail.com@hotmail.com
1          0.02%  petrus.marwan@gmail.com
1          0.02%  pett @att.net @aol.com @yahoo.fr txt 2013
1          0.02%  pharma trade exhibitors ail.comlist @hotm
1          0.02%  phase diagram of copper-graphite composite pdf
1          0.02%  phd @yahoo .com slovakia
1          0.02%  phd@yahoo.com estonia
1          0.02%  philippe @bluemail.ch@bluewin.ch@tele2.ch 2013
1          0.02%  philippines insurance association directory email .xls
1          0.02%  phlip@yahoo.com@hotmail.com@gmail.com@aol.com
1          0.02%  phosphoric acid wanted@hotmail.com
1          0.02%  pierre@inbox.st xcl
1          0.02%  pioneer directories agents in ukraine fax phone@earthlink.net@aol.com
1          0.02%  pipes import
1          0.02%  pipes manufacturing import
1          0.02%  plastic buyers @email
1          0.02%  plastic cap @gionline.com.au
1          0.02%  plastic companies in japan ahmed@yahoo.com gmail.com
1          0.02%  plastic dealers@yahoo.com @hotmail.com @gmail.com
1          0.02%  plastics manufacturing companies in china with their email addresses @yahoo.com txt
1          0.02%  pll root photos bianca 2520glam 2520shot jpg bianca beauch imgres
1          0.02%  pngseximages
1          0.02%  police@yahoo.com nl
1          0.02%  polina @gmail.com @sbglobal.net txt/2013
1          0.02%  polish yahoo.pl hotmail.com.pl@yahoo.pl 2013
1          0.02%  politicscompaniesdoctors@comcast.net@yahoo.com@hotmail.com@gmail.com
1          0.02%  porn hub sextube russi@ hot vedioes
1          0.02%  porn pic @baidu
1          0.02%  porn videos of tania asef
1          0.02%  pornici wc 0000000000
1          0.02%  porno .hotmail
1          0.02%  porno sexe arab saoudin
1          0.02%  porno.com.rita.catilagi
1          0.02%  pornos steffendd@gmail com
1          0.02%  pornos steffendd@gmail. com de
1          0.02%  pornvedio
1          0.02%  pornعنيف
1          0.02%  porosity electrospun
1          0.02%  porous cartilage-derived matrix scaffolds for repair of articular cartilage defects
1          0.02%  post on of wart blogs comment @yahoo.com @gmail.com -
1          0.02%  potrzebuję pożyczki@yahoo.co @hotmail.co @gmail.co
1          0.02%  poultry supplies@yahoo.com
1          0.02%  ppt bone regeneration sign
1          0.02%  pr puerto rico@yahoo@hotmail@gmail@ymail@aol@outlook@livemail@aim@blumail@2013
1          0.02%  prarllolitas019.jpg
1          0.02%  preciousdaniel1000@ymail.com
1          0.02%  preserve lyophilization
1          0.02%  president and ceo@aol.com @scb
1          0.02%  printing machine suppliers in pakistan @yahoo.cn @yahoo.com.cn @gmail.com @hotmail.com @live.cn @163.com @123.com @126.com-scam
1          0.02%  private business in export and import in philippines@@yahoo.com@@gmail.com@@hotmail.com.txt
1          0.02%  private company in netherlands 2012-2013 @yahoo.com @hotmail.com @gmail.com @aol.com @mail.com
1          0.02%  private investor mansur @yahoo. @gmail @hotmail
1          0.02%  private owners of machine servicing company email in iraq 2013 yahoo.com
1          0.02%  priya.sexuht..com
1          0.02%  production companies in china @yahoo.cn @gmail.com @hotmail.com
1          0.02%  prof. d @hotmail.com @msn.com -scam txt
1          0.02%  prof. dr. ahmed m. a. el-sayed mathematics @hotmail.com
1          0.02%  prof. dr. zamir ahmed @yahoo email list participants
1          0.02%  programa blj prosmotro vibora v vkontakte ru
1          0.02%  prontube1/niches
1          0.02%  protein denaturing in eggs by ionic compund experiment pdf
1          0.02%  pump import
1          0.02%  pvc film buy@africaonline.co.ci
1          0.02%  pvt ltd @yahoo.in or @yahoo.com or @rediffmail.com or @vsnl.net or @gmail.com filetypedoc indian importers/exporters
1          0.02%  py this link to share search ... site url: http://azbul.net/2013/ja-jp/
1          0.02%  qatar co. ltd (974) (cooking oil) @yahoo.com
1          0.02%  qatar motor companise email address guestbook 20132 @yahoo.com
1          0.02%  qatar oil and gas company directors @yahoo and hotmail
1          0.02%  qatar oil company business mens seeking women web email search@yahoo.com@gmail.com@hotmail.com
1          0.02%  qater@ women wives@rich@yahoo.com hotmail.com
1          0.02%  qbmqatar@qatar.net.qa
1          0.02%  qeenie hotmail com filetype txt
1          0.02%  qing brain@yahoo.com.hk
1          0.02%  quantitative assessment of the response primary derived human osteoblast
1          0.02%  quantitative cell culture biocompatibility testing of medical devices and correlation to animal tests
1          0.02%  quatar ltd@yahoo.com@gmail.com@msn.com@hotmail.com xls
1          0.02%  queen @gmail.uk @yahoo.uk @hotmail.com txt
1          0.02%  r % @aol.com @hotmail.com @gmail.com @yahoo.com @fuse.net @sbcglobal.net @yahoo.co.in @yahoo.com.my @yahoo.com.sg @yahoo.fr @ho
1          0.02%  raheem@yahoo.com @hotmailcom @gmail.com @aol.com @yahoo.com.jp @yahoo.com.au @yahoo.com.ru united state of america
1          0.02%  rajwap.com2012
1          0.02%  raul@yahoo.comhotmail.comgmail.comyahoo.co.ukrediffmail.com
1          0.02%  ravaglioli et al. 1996
1          0.02%  raw materisals suppliers @yaho.cn @hotmail.cn
1          0.02%  reaction to cement bone graft
1          0.02%  reactions metal surface osteoblasts
1          0.02%  real estate agent in south florid @yahoo @gmail @hotmail
1          0.02%  real estate entrepreneurs @yahoo.com @hotmail.com @gmail.com @163.com @bigpond
1          0.02%  real estate management @yahoo.ca @aol.com @omantel.net.om @eim.ae 2013
1          0.02%  real estate owners in luxembourg @yahoo.com@gmail.com@aol.com@att.net@verizon.netsbcglobal.com txt 201120122013
1          0.02%  real estates @aol.com txt 2013
1          0.02%  realestate owners in canada @gmail.com @yahoo.com @hotmail.com @aol.com
1          0.02%  realtors in isreal email directory 2013 @aol.com @gmail.com @yahoo.com
1          0.02%  rebecca @yahoo.com.cn @gmail.com -
1          0.02%  recent email list of garment suppliers @yahoo.com @hotmail.com
1          0.02%  rechnerwww.ecmjournal.org
1          0.02%  recognition of human chondrocytes in mouse
1          0.02%  red marine 68@ hotmail.fr
1          0.02%  redetube brasil sao paulo sapo penpa
1          0.02%  redwab xic japan 10 tu
1          0.02%  redwap girl schoolsxxx
1          0.02%  reen@gmail.com@yahoomail.com@hotmail.com@aol.com2013
1          0.02%  regenerative medicine 2013 ecm
1          0.02%  regenexx plm
1          0.02%  registreted facebook@yahoo.com
1          0.02%  remax agentbusiness mencarpenterlawyerssellers and buyers companies using @yahoo.com@aol.com@comcast.net@sbcglobal.net@verizon.
1          0.02%  reprogramming dental stem cell
1          0.02%  research study using animal
1          0.02%  resort cabin cottage@hotels.com info@gmail.com/new zealand
1          0.02%  retired management consumer @aol.com
1          0.02%  retired revenue officer @aol.com
1          0.02%  reto company @yahoo.com @gmail.com -private
1          0.02%  review large animal models bone
1          0.02%  rhonda@gmail.com@yahoomail.com@gmail.com@sbcglobal.net@mail.com@att.net txt txt txt txt 201
1          0.02%  rice %@yahoo.com %@hotmail.com %@gmail.com co. ltd 2013
1          0.02%  rice exporters
1          0.02%  rice exporters directory philippines @yahoo.com @gmail.com @hotmail.com @163.com
1          0.02%  rice exporters in thailand @yahoo.com @gmail.com @hotmail.com
1          0.02%  rice@yahoo.com@hotmail.com
1          0.02%  richard@yahoo.com au 2013 -419 -scan -report -police
1          0.02%  richbusinesswomen@cumcast@yahoo.com
1          0.02%  ricky@jpmails@yahoo.com@hotmail.com@gmail.com@aol.com2013
1          0.02%  risk factors for adjacent segment disease after cervical spinal fusion
1          0.02%  rita@gmail.com@yahoo.com@mail.com@hotmail.com
1          0.02%  rita@yahoo.com@gmail.com@hotmail.@com 2013
1          0.02%  riyadh@gmail.com@yahoo.com@hotmail.com@ymail.com text
1          0.02%  rmmut66@sbcglobal.net
1          0.02%  robert@yahoo.de filetype: xls
1          0.02%  roberts*txt* @hotmail.com@aol.com@comcast.net@verizon.net@sbcglobal.net@cox.net@yahoo.com@inbox.ru 2012
1          0.02%  robertscott@sympatico.ca@myaccess.com.au@pacific.net.sg 2013
1          0.02%  rodgers @aol.com@comcast.com@yahoo.com.br@hotmail.com2013text
1          0.02%  rodolfo @hotmail.com @yahoo.com @aol.com @bellsouth.net tes sock 2013 or 2014
1          0.02%  roger@yahoo.co.uk roger@hotmail.com.ca roger@yahoo.com csv
1          0.02%  ronald@yahoo.com@gmail.com@hotmail.com
1          0.02%  roofing steel @ nesma.net.sa
1          0.02%  roofing steel companys in nigeria @email
1          0.02%  rose @gmail.com @yahoo.com @hotmail.com @aol.com txt 2013
1          0.02%  rose @yahoo @hotmail
1          0.02%  rose@gmail.com@aol.com@yahoo.com@hotmail.com xls 2012
1          0.02%  rose@yahoo.com@aol.com@gmail.com@hotmail.com
1          0.02%  rosemary@aol.com@gmail.com@ymail.com@hotmail.com@rocketmail.com
1          0.02%  rosillo@yahoo.com@hotmail.com@gmail.com@aol.com@comcast.net@att.net txt
1          0.02%  roy @gmail roy@gmail.com @rediffmail.com@aolgmail
1          0.02%  ru.david@mail.com@yahoo.com@gmail.com@hotmail.com
1          0.02%  rubber vip.163.com @aol.br
1          0.02%  rusian companies email williams@hotmailyahoogmailaol.com
1          0.02%  russia 7 ad for seafood producer dealers seller buyers@yahoo.com@gmail.com@hotmail.com
1          0.02%  russian men koroan woman video opan
1          0.02%  ryan @yahoo.ca @gmail.com @hotmail.ca @aol.com @hotmail.com @ymail.com @yahoo.cn @mail.com @yahoo.co.uk @outlook.com companies 
1          0.02%  sabine fuchs harald schmidt angiogenesis
1          0.02%  sadig 84 @yahoo. com
1          0.02%  saech sex vdeo
1          0.02%  sainaliy. sxey. vidso com
1          0.02%  sales of gold machine yahoo.com 126.com
1          0.02%  sales person ksc construction machinery co ltd contact email yahoo com cn hotmail com gmail com china
1          0.02%  sales@126.com .txt
1          0.02%  salim.saeed@hotmail.com@gmail.com@yahoo.com@mynet.com@yahoo.my
1          0.02%  samantha @yahoo .com @gmail .com @hotmail. com t emails 2013 txt
1          0.02%  sami.al said@hotmail.com 2013
1          0.02%  sampoll @yahoo.com@aol.com@hotmail.com@concast.net@cox.net@rogers.com
1          0.02%  samson@yahoo.com.sb @hotmail.com.sb @gmail.com.sb @ymail.com @live.com
1          0.02%  samsun escort janefe telefon no
1          0.02%  samuel 41@hotmail.com.cnyahoo.comaol.com 2013 roster
1          0.02%  san francisco @yahoo. com @gmail.com @aolmail.com @hotmail.com
1          0.02%  san francisco ritired workers teachers workers retailers nurses @comcast.com sbcglobal.net yahoo.com @live.com @aol.com
1          0.02%  san lorenzo 37 @gmil. como
1          0.02%  sandi ramana @yahoo
1          0.02%  sandra.novo@hotmail-com.br.@gmai2.com
1          0.02%  sandraaustin_55@yahoo.com
1          0.02%  santos yahoo.co.ukgmail.com -2013
1          0.02%  sara @ yahoo.com.pa gmail.com.pa hotmail.com.pa aol.com.pa live.com.pa domain.com.pa
1          0.02%  sarah @yahoo.com.au 2012 txt @yahoo.com.au or @gmail.com or @hotmail.com.au sarah@yahoo.com.au -not -scams -addressess
1          0.02%  sarah good luck @h otmailcom
1          0.02%  sarah@yahoo.comgmail.comhotmail.comaol.comgmx.com
1          0.02%  saudi arabia @yahoo.com @gmail.com @hotmail.com @oal.com
1          0.02%  saudi arabia business directory online with full email address gamil.com or or yahoo.com hotmail.com or yahoo.cn or mail.com
1          0.02%  saudi arabia business directory. gmail.com or hotmail.comyahoo.com
1          0.02%  saudi arabia business email list @hotmail.com 2013
1          0.02%  saudi arabia executive directors @yahoo.com gmail.com hotmail.com 2013
1          0.02%  saudi arabia men online emails 2013 @hotmail.com
1          0.02%  saudi arabia men seeking women fax @hotmail.com
1          0.02%  saudi arabia pen pals @yahoo.com@gmail.com@hotmail.com@rediffmail.com@aol.com
1          0.02%  saudi arabia textile importers 2013 @yahoo.com @hotmail.com
1          0.02%  saudi arabian physicians list hotmail com 966 @yahoo.sa
1          0.02%  saudi factories directory @gmail.com
1          0.02%  saudi/jordan @hotmail.com members @yahoo.com emails
1          0.02%  saudia2010@yahoo xxx
1          0.02%  saudiarabiasexy
1          0.02%  sayeed@gmail.com@hotmail.com@gmail.com@aol.com@cox.net
1          0.02%  sayeed@yahoo.com@hotmail.comgmail.com txt 2013
1          0.02%  sb.com.‎احلي نيكwww.‎
1          0.02%  scammers emails address in malaysia 2013 @yahoo.com
1          0.02%  scammers list 2013yahoo.com
1          0.02%  scanning electron microscopy journal
1          0.02%  scanning microscopy int
1          0.02%  schneider @web.de/@aol.de/@aon.at/@gmx.de 2013
1          0.02%  scholars in plants university china gmail yahoomail .edu
1          0.02%  school directory universities in united states @edu @gmail.com 2013
1          0.02%  sco@yahoo.com@hotmail.com@gmail.com@aol.com 2011 txt
1          0.02%  scott @yahoo.com txt usa
1          0.02%  scott filetype or txt @yahoo.com @gmail.com hotmail.com -scam- -fraud
1          0.02%  scott@aol.com @gmail.com @hotmail.com @blumail.com txt 2013
1          0.02%  scott@cox.net @gmail.com @comcast.net 2013 text
1          0.02%  scrap metal @126.com @163.com @gmail.com @hotmail.com @aol.com @live.com txt asia 2013
1          0.02%  sds.sanda@gmail.com
1          0.02%  sea food suppliers vn @163.com @yeah.com @gmail.com
1          0.02%  seartc facebook of elisa bigbig http://www.google.com/webhpclient=ms-android-verizon
1          0.02%  seksiy 69@. com
1          0.02%  selim.benny@hotmail.com@gmail.com@yahoo.com@aol.com
1          0.02%  selim.salah@gmail.com@hotmail.com@aol.com@yahoo.com@hotmail.kw
1          0.02%  selinas @yahoo.es @hotmail.com @juno.com @netzero.net @earthlink.net @bellsouth.net 2012/2013
1          0.02%  sepax marrow concentrate
1          0.02%  sepax pseudarthrosis
1          0.02%  serch kideny buying contact.
1          0.02%  sergio@gmail.co.uk@hotmail.co.uk@yahoo.co.uk@aol.co.uk
1          0.02%  sex gamant kallo 3gp
1          0.02%  sex garl www@
1          0.02%  sex video mb3 للجوال حيونات وبنات
1          0.02%  sex video melayu @g com
1          0.02%  sex wap w w w@ pak
1          0.02%  sex xx porno xnxx noryan
1          0.02%  sexjniferlopez
1          0.02%  sexketo.moc
1          0.02%  sextubegoogle.com.vn
1          0.02%  sexual @homail .com
1          0.02%  sexvedioeurop
1          0.02%  sexvideoafreka
1          0.02%  sexvideopilipino@yahoo.com
1          0.02%  sexwww.com 12sal ke
1          0.02%  sexy sxsyahoo
1          0.02%  sexybabesz
1          0.02%  sexybabesz.com:index%20of%20password
1          0.02%  sexبزرگ
1          0.02%  sexبنات مع حصان
1          0.02%  sexشيمل
1          0.02%  shahin sayed 2007@indiatimes.com
1          0.02%  shamaels sex skachat
1          0.02%  sheikhmohammeed@gmail.com
1          0.02%  sheikmohamed673@yahoo.com
1          0.02%  shekhmustafa @hot mail
1          0.02%  shen jy j biomed mater res b 77:423–430.
1          0.02%  shirley@shaw.ca filetype: xls
1          0.02%  short bouts of mechanical loading are as effective as dexamethasone at inducing matrix production by human bone marrow mesenchy
1          0.02%  should a articular cartilage defect be repaired
1          0.02%  shull @hotmail.com@gmail.com@ymail.com@aol.com @yahoo.com -2013
1          0.02%  sidhiq poyyl @gmil. com
1          0.02%  silicone vertabrae discs
1          0.02%  simple knee drawing
1          0.02%  singapoer feer sexxy .coom
1          0.02%  singapore chong@yahoo.com.sg sheet1
1          0.02%  singapore cotton producers sellers manufacturers @yahoo @gmail
1          0.02%  singapore wart blogs on comment @yahoo.com @gmail.com @aol.com @mail-
1          0.02%  singh @yahoo.com @gawab.com @rediffmail.com @emirates.net.ae @yahoo.co.in @qatar.net.qa @sympatico.ca sql
1          0.02%  singnet.com.sg 123456 password @singnet.com.sg or @@gmail.com @ @ @
1          0.02%  site pvc suppliersmanufacturers-cn@yahoo.com @gmail.com @hotmail.com@
1          0.02%  sites mit business catalyst e-mail und rocketmail.com yahoo.de deutsch
1          0.02%  sleazydream _com
1          0.02%  sm @yahoo.com@hotmail.com@gmail.com@bellsouth.net@eartlink.net txt 2011
1          0.02%  smell girl 15yair xnxx
1          0.02%  smf 2.0.2 real estate
1          0.02%  smith 1 @yahoo.com @aol.com @gmail.com @hotmail.com @juno.com @redifmail.com 2013
1          0.02%  smith edward@yahoo.com@gmail.com@hotmail.com@aol.com@text
1          0.02%  sms-concast.ch/de/unternehmen/sms-concast-auf-einen-blick.html
1          0.02%  sode.arb.sax.sage.com
1          0.02%  sofa company@yahoo @yahoo.fr @yahoo.ca @yahoo.se @hotmail.com @aol.com
1          0.02%  soft drinks product companies @163.com @126.com @sina.com china
1          0.02%  solo@live.comgmail.com@aol.com@msn.com@yahoo.co.uk@att.nettxt2013
1          0.02%  sonia@yahoo.com @gmail.com 2012
1          0.02%  sonja @yahoo.com @gmail.com -domain
1          0.02%  sonya 80 ferguson@yahoo.com/txt
1          0.02%  sonyasanchezc@yahoo.com
1          0.02%  sophia@aol.comisabella@att.net guestbook 2014
1          0.02%  south africa poultry equipment @yahoo.com @ hotmail.com @126.com @gmail.com @163.com.co.za
1          0.02%  south africans emails @yahoo.com @gmail.com @ymail.com @rocketmail.com @hotmail.com @msn.com txt
1          0.02%  south korea products export @126.com @hotmail.com
1          0.02%  sozan 86@ hotmail
1          0.02%  spain fiber manufacturer email @yahoo.com filetype:pdf or filetype:doc orfiletype:xls
1          0.02%  spare parts @hotmail.cn gmail.com
1          0.02%  spinal disc filler
1          0.02%  spine surgery evidence based practice pdf
1          0.02%  spine surgery pdf
1          0.02%  spine surgery: past present and future
1          0.02%  sports action camera @yahoo.co.au
1          0.02%  sr. hussain @webmail.co.za @vodamail.co.za
1          0.02%  ssb supplement
1          0.02%  staphylococcus ecm
1          0.02%  star.zhaoyahoo com.c
1          0.02%  statistiken ecm jornal porno dns abmahnung
1          0.02%  statistiken für: www.ecmjournal.org
1          0.02%  steel and alluminium manufactureres directory @yahoo.com @hotmail.com @123.com xls
1          0.02%  steel companies in asia@yahoo.com@gmail.com@hotmail.com@4share.com
1          0.02%  steel companies in asia@yahoo.com@gmail.com@hotmail.com@4share.com@craigslist.com
1          0.02%  steel elbow @yahoo.co.br
1          0.02%  steel import and export trading co ltd @163.com @vip.163.com @mail.com
1          0.02%  steel pipe@ttnet.net.tr
1          0.02%  steel suppliers manufacturing companies iraq list pdf file hotmail.com gmail.com yahoo.com
1          0.02%  steel wire rod @club-internet.fr email
1          0.02%  steel@omantel.net.om
1          0.02%  stellalarry 74@yahoo
1          0.02%  stem cell pricing per ml
1          0.02%  stem cells and tooth regeneration
1          0.02%  stem cells for tooth engineering
1          0.02%  stem cells treatment to join pain and relief
1          0.02%  stephanie silva-2oo 1 @hotnail. com
1          0.02%  stimulation of bmp-2 expression by pro-inflammatory cytokines il-1 and tnf-α in normal and osteoarthritic chondrocytes
1          0.02%  stimulation of bone regeneration
1          0.02%  stimulation of il-1b and chondrocytes
1          0.02%  strategies cartilage defects reparation
1          0.02%  strategies for engineering cartilage with improved content and organization
1          0.02%  stress mechanical glutamate
1          0.02%  studantporn
1          0.02%  students @msn @yahoo @gmail@hotmail
1          0.02%  suchen ein darlehen von 5000 in deutschland heute @web.de @gmail.com @yahoo.de 2013
1          0.02%  sucker rod @gmail
1          0.02%  sudan importers and exporters @yahoo @gmail @hotmail .xls
1          0.02%  sudiarabiasexy
1          0.02%  sugar suppliers @yahoo.com@hotmail.com@aol.com@163.com@gmail.com@comcast.com filetype :xls
1          0.02%  sugarcane time and depth of planting pdf
1          0.02%  suisse zurich liste des agréés @gmail.com @bluwing.ch 2013
1          0.02%  sumon ahmed iran @gmil. com
1          0.02%  sunny.leon.org/finanz.htmlafdt=
1          0.02%  supplied furnitures and aluminium roofing materials at yahoo.com ymail.com gmail.com netmail.com mail.com in united state
1          0.02%  supplier of copper scrap kong @yahoo llc.xls
1          0.02%  supplier of copper scrap lee chu @yahoo llc.xls
1          0.02%  supplier of jewelry in china at aol.com at hotmail.com at verizon.net 2013
1          0.02%  supplier of shoes john lung @yahoo llc .xls
1          0.02%  suppliers / industries @yahoo.co.kr @yahoo.com @yahoo.co.ke
1          0.02%  suppliers @yahoo.com @ yahoo.com.cn @yahoo.jp
1          0.02%  suppliers and buyers of transformers @yahoo com yahoo de yahoo co ae
1          0.02%  suppliers and dealers of machinery in india @yahoo @gmail @hotmail
1          0.02%  suppliers and dealers of tiles in india @123 @163 @yahoo
1          0.02%  suppliers and manufacturers of chemical
1          0.02%  suppliers in russia @gmail.com@yahoo.com hotmail.com
1          0.02%  suppliers manufacturers exporters of rice @hotmail.com @yahoo.com @cyber.net.pk @brain.net.pk
1          0.02%  suppliers of building materials in china @yahoo.cn @gmail.com @hotmail.com
1          0.02%  suppliers of hospital equipment @yahoo.cn @hotmail.cn
1          0.02%  suppliers of hospital equipment in usa and china @yahoo.com126.com163comgmail.comhotmail.com
1          0.02%  suppliers of steel @yahoo gmail @trade.co
1          0.02%  suppliers product baby foods director@gmail.com@aol.com@yahoo.com@hotmail.com@mail.com in 2013
1          0.02%  suppliers@yahoo.com@hotmail.com@aol.com@gmail.com llc
1          0.02%  suppliersdistributor companies info@hinet.
1          0.02%  suppression email list txt benson@yahoo.com@hotmail.com@gmail.com@aol.com 2013txt
1          0.02%  suppression txt jose @live.com.mx @terra.com.mx
1          0.02%  surface activation cobalt chrom
1          0.02%  surface modification nano zinc oxide in polymer mechanical pdf
1          0.02%  surfingbangladesh@yahoo.com
1          0.02%  susanpaulmatthew using @aol.com@yahoo.com@hotmail.com@verizon.net@comcast.net@att.net@sbcglobal.net@live.com@gmail.com and webm
1          0.02%  suzan @yahoo.com @hotmail.com @gmail.com usa tx 2012
1          0.02%  suzana client=ms-opera_mb_no
1          0.02%  suzanne@yahoo.com@hotmail.com@gmail.com@aol.com@earthlink.net@mail.ru@att.net txt
1          0.02%  switzerland business buying and selling of ships owners emails @yahoo.com @hotmail.com @gmail.com @aol.com txt 2013
1          0.02%  sxsشميل
1          0.02%  sydney @yahoo @gmail .txt 2012
1          0.02%  synthetic diamond buyer @gmail
1          0.02%  synthetic diamond@aol.com
1          0.02%  sمقاطع سكس ﻭﺻﻮﺭ
1          0.02%  t tom @yahoo.com @hotmail.com @aol.com @gmail @finland :txt.
1          0.02%  taecher @yahoo .com slovakia
1          0.02%  tai @hotmail @yahoo
1          0.02%  tailoring self-assembled octapeptide scaffolds for in-vitro cartilage repair
1          0.02%  taiwan email addresses .@yahoo.@hotmail.com
1          0.02%  taiwan engine llc @yahoo@hotmail@gmail@163.com@126.com
1          0.02%  taiwan gmail.comhotmail.comaol.comqq.com 2013
1          0.02%  taiwan industrial suppliers co ltd @hotmail.com.tw xls
1          0.02%  taiwan meng@yahoo.co.id@hotmail.com@gmail.comymail.com2012
1          0.02%  taiwan oil and gas ceo @gmail.com @yahoo.com.tw
1          0.02%  tajikestan materials journal impact factor
1          0.02%  tamil x videos .com2010
1          0.02%  taylor @att.net@@yahoo.com@@gmail.com@hotmail.com@@bigpond.com txt
1          0.02%  taylor santos 2011@ hotmail.com
1          0.02%  taylor@yahoo.com @hotmail.com @gmail.com 2013 txt
1          0.02%  tces supplements ecm
1          0.02%  technovit9100
1          0.02%  tel 61 @gmail.com @hotmail.com @att.net @aol.com @yahoo.com 2012/13
1          0.02%  tel: 354 co pty owner ceo ltd sales/dealer/distributor@hotmail.com
1          0.02%  telecommunication companies email in europe@yahoo.com@gmail.com@hotmail.com@4share.com
1          0.02%  tell us ceo co.product of fabrics agent on email@hotmail.com
1          0.02%  telugu wapfriendship day images
1          0.02%  tem fixation decalcification
1          0.02%  tense methods and materials uk
1          0.02%  tetronic 1107 gel
1          0.02%  textile @yahoo.co.id @gmail.com manufacturers and exporters xls
1          0.02%  textile fabrics buyer and importer and distributer @club-internet.fr -alibaba -tradekey
1          0.02%  textile industry and manufacture and importers and exporters@yahoo@hotmail@gmail@126
1          0.02%  textile suppliers @gmail.com @yahoo.com @hotmail.com @outlook.com @live.com @126.com @163.com
1          0.02%  textile suppliers @yahoo.com@hotmail.com@aol.com@163.com@gmail.com@comcast.com filetype :xls
1          0.02%  textiles coating co. ltd
1          0.02%  textiles import and export co. ltd
1          0.02%  textlies manufactures and importer and exporters@yahoo@gmail@hotmail@126
1          0.02%  tgp cement@yahoo com.my
1          0.02%  thailand emails address of stock broker @yahoo @hotmail @gmail
1          0.02%  thailand oil company zone yahoo com gmail com hotmail com rocket mail com
1          0.02%  the characterisation of mesenchymal stem cells: a stem cell is not a stem cell pdf
1          0.02%  the degradation behavior of mg-­‐3zn-­‐0.5zr alloy inan in vitro and in vivo environment
1          0.02%  the development of a bioengineered organ germ method.
1          0.02%  the effect of peptide surface density on mineralization of a matrix deposited by osteogenic cells
1          0.02%  the measurement of skeletal muscle in antioxidants pdf
1          0.02%  the use of nasal epithelial stem/progenitor cells to produce functioning ciliated cells in vitro.
1          0.02%  theresa@yahoo.com @hotmail.com @aol.com @gmail.com txt
1          0.02%  thomas@gmail.com txt
1          0.02%  thomas@yahoo.com@hotmail.com@comcast.net@aol.com@gmail.com
1          0.02%  thomas@yahoo.comgmail.comhotmail.comaol.com
1          0.02%  thomson @yahoo.com. @gmail.com @outlook.com. @hotmail.com. filetype.pdf 2013
1          0.02%  thomson@gmail.com@yahoomail.com@hotmail.com2013
1          0.02%  tiffany 2011 @yahoo.com.sg @yahoo.com.ph hk
1          0.02%  tiffany2009@daum.net
1          0.02%  tile importer: @gmail.com.ec
1          0.02%  tiles co. ltd @gmail.co.th @yahoo.co.th @hotmai l.co.th
1          0.02%  tiles manufacturers in spain and china yahoo craiglist 4shared gmail hotmail 126 vsln
1          0.02%  tin @yahoo.com.cn /2013
1          0.02%  tin box buy @nesma.net.sa
1          0.02%  tin box buy@comcast.net
1          0.02%  tin box@aol.com
1          0.02%  tissue material research conference 2014
1          0.02%  titanium dioxide @wilnetonline.net email
1          0.02%  titanium dioxide yahoo @amet.com.aremail
1          0.02%  titanium dioxide yahoo @aviso.ci;email
1          0.02%  titanium oxide yahoo @africaonline.co.zw email
1          0.02%  tmail.mypo.sexy.3gp
1          0.02%  toilet paper@hotmail.com
1          0.02%  toner yahoo.co.fra
1          0.02%  tooth stem cell therapy
1          0.02%  tooth-derived stem cell
1          0.02%  top companies seeking for investors in canada @gmail.com@yahoo.com@hotmail.com
1          0.02%  tractor dealers alibaba @yahoo.com @aol.com @hotmail.com 2013 -
1          0.02%  tractors dealers email\fax @ yahoo.com @hotmail.com @gmail.com @126.com
1          0.02%  trade directory jordan @ hotmail.com
1          0.02%  tradekey pakistan buyers-importers @yahoo.com @163.com 2013
1          0.02%  trader auto spare parts of japanese cars in thailandimport export co.ltd. @gmail.com @yahoo.com.tr
1          0.02%  traders guestbook 2013 @ hotmail.com
1          0.02%  traders mail@yahoo.com txt
1          0.02%  traders selling car parts in asia email addresses @yahoo@hotmail@gmail.com
1          0.02%  trading companies in vietnam @yahoo.com.vn @hotmail.com @gmail.com
1          0.02%  trading llc of tractors manufacturers in china/hong kong@163@aol @yahoo@msn@live@gmail@hotmail@live
1          0.02%  traxanie human with animals
1          0.02%  truck manufacturer co ltd @163.com @vip.163.com @mail.com
1          0.02%  truck1.eu importers and exporters companies @yahoo.com @gmail @hotmail.com
1          0.02%  trucks parts suppliers in china '' ''@hotmail '' ''@msn'' ''@live
1          0.02%  tube8.comألامارات
1          0.02%  tubepornfilm tubes arab1 shtml
1          0.02%  tuguluxxc
1          0.02%  turkey machinery suppliers @yahoo hotmail
1          0.02%  turkey refrigerator manufacturers‎@hotmail.com @yeah.net-2013xls
1          0.02%  turkey yahoo.com ymail.com hotmail.com
1          0.02%  turki@yahoo.co.es xsl 2013
1          0.02%  two-dimensional/three-dimensional cell culture of chondrocytes on self-assembled octapeptide scaffolds
1          0.02%  txt 1 peter gmail hotmail aol gmx sbcglobal 2013
1          0.02%  txt @aol.com @yahoo.au 2013
1          0.02%  txt @hotmail.com @une.net.co @yahoo.com 2013
1          0.02%  txt @yahoo.com @hotmail.com @gmail.com @ aol.com @sbcglobal.net
1          0.02%  txt doctors farmers @gamil.com @hotmail.com @yahoo.com @yahoo.ca 2013
1          0.02%  txt plastics producers glass producers @yahoo.com @gmail.com @hotmail.com 2013
1          0.02%  typefile:txt electric vehicle hotmail.com
1          0.02%  u s a @yahoo.com@aol.com@hotmail.com@yahoo.co.uk@att.com@yahoo.co.net mercy 2012..2013
1          0.02%  u.s. sales of bone graft and bone substitutes 2000 - 2010
1          0.02%  u.s.a @yahoo @gmail @hotmail
1          0.02%  uae buyers/ sellers/producers/manufacturer @yahoo.com @gmail.com@hotmail.com
1          0.02%  uae gold buyers email yahoogmailaolhotmail
1          0.02%  uae importers @yahoo.com @gmail.com @hotmail.com
1          0.02%  uganda business emails@ aol.com @yahoo.com @ gmail.com.@hotmail.com
1          0.02%  ukpowered by smf small business”
1          0.02%  ultrastructural of bone and cartilage pdf
1          0.02%  umrechner 86000.00 kzt
1          0.02%  united states of america john kerry ile kontaktemail adresleri
1          0.02%  updated email address of frank from aolyahoomsn 2013
1          0.02%  urgent business partner needed for my farm @yahoo.ca @sbcglobal.net @earthlink.net @yahoo.us in 213
1          0.02%  uropianse.xls
1          0.02%  us ny retired worker's women rebecca @aol.com @gmail.com 2013 txt
1          0.02%  usa business emails @aoi.com.@ yahoo.com @ hotmail.com txt
1          0.02%  usa daily index @yahoo.com @hotmail.com @aol.com @gmail.com @cs.net files txt
1          0.02%  usa james m. foster jr @ yahoo.ca @ aol.com @ hotmail.com txt usa
1          0.02%  usa leads geust book @yahoo.com @aol.com @hotmail.com @yahoo.ca 2013
1          0.02%  usa trucks for dealer directory 2013 @aol.com only
1          0.02%  usa_farmers_gustbook@aol.com@gmail.com@yahoo.com 2013 csv
1          0.02%  usasmith'' @yahoo.com.cn@yahoo.com @hotmail.com@gmail.com@163.com -spam
1          0.02%  used car dealers @aol.com @ gmail.com @126.com germany txt 2013
1          0.02%  username password @myspace 2013 filetype txt
1          0.02%  username@gmail yahoo hotmail
1          0.02%  uses of nanotubes in medicine
1          0.02%  usman hameed hameedu@rba.gov.au
1          0.02%  uthman @msn.com txt
1          0.02%  van penc @yahoo.nl @hotmail.nl @home.su @gmx.com @gmail.su @chello.us 2013 txt
1          0.02%  vanessa silva 17@ outlook.com.br
1          0.02%  variation in contact guidance by human cells on a microstructured surface
1          0.02%  vascularisation cv system
1          0.02%  vdeo zex @yahoocom
1          0.02%  vedioproxy organization
1          0.02%  vesenka j. manne s. yang g. bustamante c. and henderson e. (1993) scanning microsc. 7 781–788
1          0.02%  vicky @hotmail.com@gmail.com@ymail.com@aol.com @yahoo.com -2013
1          0.02%  victor profile @face book.com
1          0.02%  victor@att.net.mx
1          0.02%  videos xxx dragonaol gt
1          0.02%  vidioporno2
1          0.02%  vidioسكس
1          0.02%  vietnam profile contact email @hotmailcom 2013
1          0.02%  vilage x pasto .net
1          0.02%  vince martinez 602@gmail profiles
1          0.02%  virgin xxx xfree movies xxx virg
1          0.02%  vivian john@ hotmail.com @ gmail.com @ yahoo.com
1          0.02%  việt nam dirctors managers@yahoo.com.vn @ hotmail.com @ gmail.com @ ovi.com
1          0.02%  volume of fish scales collection in the philippines
1          0.02%  w ww iran joetagoo com
1          0.02%  w ww xxx @yahoo com
1          0.02%  w.w.six aima khan com.pk
1          0.02%  w.w.w. mobail bengali be .vedio com.
1          0.02%  w.w.w.com wap @my sax
1          0.02%  w.w.w.google sex naked fucked gril with men.comn
1          0.02%  walker@yahoo.com@aol.com@hotmail.com txt
1          0.02%  warren@aol.com hussain@yahoo.com txt csv
1          0.02%  washer extractor import@webmail.co.za
1          0.02%  washington@yahoo.com@ymail.com@gmail.com@otmail.com@aol@tkt
1          0.02%  water treatment and europe ewta / inurl :pdf
1          0.02%  watson@yahoo.com.uk watson@rocketmail.com.ca watson@hotmail.com.hkwatson@gmail.com.qa watson@aol.com csv
1          0.02%  webber@aol.com @hotmail.com @yahoo.com @msn.com @yahoo.ca @yahoo.com.au @yahoo.gr @txt
1          0.02%  webmail password 2013 http url/host login
1          0.02%  webmail.daiichi-sankyo.eu/owa
1          0.02%  webmaildpcnet
1          0.02%  webmd
1          0.02%  wehn@yahoo.de @hotmail.de @gmx.de @t-online.de @aol.de 2013
1          0.02%  what is biochemical stimulation for bone fracture repair
1          0.02%  what is pellet in cell culture
1          0.02%  whats.apper.blogspot.co.uk/2013/03/whatsapp-nokia-200-for nokia asha-200.htm/m=g
1          0.02%  whiteroses.2009@yahoo.com
1          0.02%  why are animals used in animal testing when the similarity between humans and animals differ
1          0.02%  williams @yahoo.ca @gmail.com @hotmail.ca @aol.com @hotmail.com @ymail.com @yahoo.cn @mail.com @yahoo.co.uk @outlook.com compan
1          0.02%  williams@gmail.com@yahoo.com@aol.com@gmail.com
1          0.02%  williams@yahoo @gmail @hotmail
1          0.02%  williams@yahoo.com@hotmail.com@aol.com@cox.net txt
1          0.02%  willson @yahoo.com @aol.com @gmail.com @hotmail.com csv 2008 2010
1          0.02%  wilson@gmail.com @aol.com @cox.net @yahoo.com @outlook.com txt
1          0.02%  wine%@gmail.com%@yahoo.com%@mail.126.com%@hotmail.com
1          0.02%  wire mesh @yemen.net.ye
1          0.02%  wire mesh buyer@mail.ru
1          0.02%  wire mesh buyer@mongol.net
1          0.02%  wire mesh import@cyber.net.pk
1          0.02%  wire rod @nesma.net.sa 
1          0.02%  wire rod@omantel.net.om
1          0.02%  wiremesh distributor @gmail
1          0.02%  wisdom@yahoo.com @gmail.com @hot mail.com@aol.com
1          0.02%  wob producers %40yahoo.de email or gmx.de email contacts
1          0.02%  women who need loan urgently @yahoo.com @hotmail.com @gmail.com txt
1          0.02%  womens and girls se x xx x to day june 2013 2014 2014 xx x
1          0.02%  wood sallers in saudi arabia email directory 2011-2013 @yahoo.com hotmail.com gmail.com
1          0.02%  workers living in saudi arabia contact email address @yahoo sa @yahoo com @gmail com @hotmail com
1          0.02%  world gusetbook 2013 @aol.ch @hotmail.com -vxz -%
1          0.02%  world heavy industry (china) co. ltd.163.com 126.com yeah.net
1          0.02%  world trading company(contact) @yahoo.com @163.com @yandex.ru @msa.hinet.net @comcast.com @yahoo.co.uk
1          0.02%  worldwide pharmaceutical companies @email.com
1          0.02%  wrist watch manufacturers switzerland @aol.com@yahoo.com@gmail.com@hotmail.com guestbook 2013
1          0.02%  wtb classified guns august 2013 @gmail
1          0.02%  ww .hotm
1          0.02%  ww youtub @sex com
1          0.02%  ww..nnnxw.drugs.com/forum/latest-drug-related-news/
1          0.02%  ww.norahnelson2012@yahoo.in
1          0.02%  ww.pornhub.xsl
1          0.02%  wwsex .for
1          0.02%  wwsixi porno mixo
1          0.02%  wwsixi vibo film
1          0.02%  wwsixrap
1          0.02%  www .arbic sex .com
1          0.02%  www .india sexy photes com
1          0.02%  www .mail @yahoo . com
1          0.02%  www .sex garlass.com
1          0.02%  www .uae girl sex xxx video
1          0.02%  www .uae sex garls.com
1          0.02%  www .yahoo .com pk
1          0.02%  www .سكس امریكا.cm.ir.
1          0.02%  www 3xxxvideos @gmil com
1          0.02%  www banglashes bangla video movie xxx 20013 com.
1          0.02%  www benjamin. icel @gmx. de benny
1          0.02%  www big pusy fuk with eanamal
1          0.02%  www ecmjornal.org porno star doris 078
1          0.02%  www egeptin sex mobil free .com
1          0.02%  www geogle@ yahoo.com
1          0.02%  www google sexcy3 photo com pk
1          0.02%  www hilyati coom
1          0.02%  www hotmail@ jose carlos .com
1          0.02%  www phmedic insurance
1          0.02%  www sexys .usa
1          0.02%  www sindhi sixy vido @com pk
1          0.02%  www tamil men breast datinggmail.com
1          0.02%  www translate. google com/m si =id
1          0.02%  www usa sex com@
1          0.02%  www vap edsein tamel.sex
1          0.02%  www xxl videi sexse @hot mail.com
1          0.02%  www yahoo@ mail.com
1          0.02%  www نيج @com
1          0.02%  www ‎سكسmco
1          0.02%  www. com @gmil
1          0.02%  www. guest@ my porn wap bd. com
1          0.02%  www. japan samll @bus girl sex 8tube video
1          0.02%  www. rajwap.com.sex.photoads
1          0.02%  www. sxs angelina @hotm fer
1          0.02%  www..garlass sex.com
1          0.02%  www.3d sixx photo pirunt.c
1          0.02%  www.505djhot.com@yahoo
1          0.02%  www.66 .2011 sexy xvidoes .com
1          0.02%  www.afgani.sxi.videos.comافغان
1          0.02%  www.anam.56yahoo.com
1          0.02%  www.animalxxxcom
1          0.02%  www.arbicsex@hotmal.com/uae
1          0.02%  www.bangla model new xxx bideo wap.com
1          0.02%  www.bobbystube.comvs/niches/arab1.php
1          0.02%  www.com.saxyes.nena
1          0.02%  www.com.sexy .vedio
1          0.02%  www.comyahoomil uvfn
1          0.02%  www.eanamals sax porhub
1          0.02%  www.ecm journal org
1          0.02%  www.ecm/kobbeh.page.t
1          0.02%  www.ecmjournal.org
1          0.02%  www.ecmjournal.org/soñts/ref_201211.html
1          0.02%  www.ecmjournal.org/stats/ref_201301.html
1          0.02%  www.emirates fone @org
1          0.02%  www.ethiopeyan girl sax.com
1          0.02%  www.free xxxvideo.com.google.com.ng/imgresimgurl=http://i.telegraph.co.uk
1          0.02%  www.free.porm 15yair garil youtop
1          0.02%  www.gh69.xxxcom
1          0.02%  www.girles beautiful breasts.com
1          0.02%  www.gmail @com
1          0.02%  www.gmail.com.mohd.yahaya @gmailcom
1          0.02%  www.gmail.com.mohd.yahaya@gmailcom
1          0.02%  www.google.com/hl=arمقاطع سكسي مصري
1          0.02%  www.google.com/mclient=uums-nokia
1          0.02%  www.google.com/mhl=fr
1          0.02%  www.google.com/mq=www. foxsports.com
1          0.02%  www.google.com/webhpسكس عربي
1          0.02%  www.google.iq/searchhl=ar
1          0.02%  www.haj commite.com
1          0.02%  www.hinde viedo sex gmail@
1          0.02%  www.horny milf olivia o lovelv xnxx.com
1          0.02%  www.injaction plastic masin passwald.com
1          0.02%  www.intitle index of wmv hasan shemaie zadeh
1          0.02%  www.ipl.dokom.2013
1          0.02%  www.javad big 67 @ .gmail
1          0.02%  www.kareem md 19@ gmail.com
1          0.02%  www.keto sxs coom
1          0.02%  www.margaret williams 56@ yahoo. com
1          0.02%  www.mcb bank girls youjizz.com
1          0.02%  www.nik porno sex arab@
1          0.02%  www.nokia.com/eg-arمقاطع فديو
1          0.02%  www.onlinsix.com
1          0.02%  www.ovi.comافغانستان
1          0.02%  www.pakestany xxx vadeo 3gp.com
1          0.02%  www.pakistan com girl fuk to eanamal
1          0.02%  www.porn mobillsex.com
1          0.02%  www.pornmovies.com/imgresimgurl=http://pub.tv2.no
1          0.02%  www.pron .asian.yahoo.com
1          0.02%  www.redwap.com2013/20000
1          0.02%  www.redwap.comفیلم
1          0.02%  www.redwap.‎‏ سکسcom
1          0.02%  www.samsung gt-e1282t support india sex collage
1          0.02%  www.sex hot egeptin
1          0.02%  www.sex.redwap.comجدید
1          0.02%  www.sex.video.indo.jw.tl
1          0.02%  www.sex.‎‏.صور.خادماتcom
1          0.02%  www.sex8.@gamil.com
1          0.02%  www.sexce viduos sawdy arab xxxxx.com
1          0.02%  www.sexy@yahoo.com
1          0.02%  www.sexyvidios .usa
1          0.02%  www.sexعربی.‏facebook‏. ‏net
1          0.02%  www.shames .hotmail com
1          0.02%  www.singlewonen email .con
1          0.02%  www.sutan @yahoo come
1          0.02%  www.sxyi garld xx vedio india .com
1          0.02%  www.usagirls xxnxx.com
1          0.02%  www.webmail.slb.com/owa
1          0.02%  www.x.‎‏.عرب.فيديو.سكسcom
1          0.02%  www.xnx.hotmail.com
1          0.02%  www.xnxx .cmo
1          0.02%  www.xnxx 3abed fahad sexs.com
1          0.02%  www.xnxx 9 s3310 com
1          0.02%  www.xnxx-cmo2
1          0.02%  www.xnxx.com2001
1          0.02%  www.xnxx.krcom
1          0.02%  www.xvideo .company
1          0.02%  www.xxx sxs .cmo
1          0.02%  www.xxxtreecom
1          0.02%  www.yahoohotfilm.com
1          0.02%  www.yahudi girl sexybabesz.com
1          0.02%  www.yandex.com.trlive jasmin hot sex
1          0.02%  www.صور.redwap.coom
1          0.02%  www.صورسكس .coom
1          0.02%  www.‎سكس حيواناتcom
1          0.02%  www.‎سنی لیون‎ ‎‏3gpsex.com
1          0.02%  www.‎‏.جنس عربيcom
1          0.02%  www000 sex xxx
1          0.02%  www2010.bnat
1          0.02%  www89 com@
1          0.02%  www999.sextgem.com/webpage/korea/10001
1          0.02%  www@ sexx videos
1          0.02%  wwwbaharainsex co
1          0.02%  wwwbaharainsex com
1          0.02%  wwwcanada xxxcoml
1          0.02%  wwwdokom 2013 xvideo
1          0.02%  wwwgoldtuba8.
1          0.02%  wwwindian girls xxx photo @con
1          0.02%  wwwmms sex fuck .sg .com
1          0.02%  wwwredtube com@
1          0.02%  wwwsex .usa
1          0.02%  wwwsexfilimi.org
1          0.02%  wwwsexfilms in lagos state com
1          0.02%  wwwsexkız.comx
1          0.02%  wwwsxs@yahoo.com
1          0.02%  wwwtubetubetube.comkh
1          0.02%  wwwusasex.dotcom
1          0.02%  wwwusasexymove
1          0.02%  wwww.doha .qutar.xxx com.
1          0.02%  wwwwسكس رجال
1          0.02%  wwwxlxx 20012
1          0.02%  wwwxxx sex @co
1          0.02%  wwwxxxmovifreedownlod.com
1          0.02%  wwwxxxsex @co
1          0.02%  wwwxxxسكس بنت الكوت
1          0.02%  wwwباكستاني سكسي تصاوير
1          0.02%  wwwسکس عربی ‏dm
1          0.02%  wwwصورسكس تركي‎.
1          0.02%  wwwمقطع فديوسكس
1          0.02%  www​.ir-tci.org/forum/ showthread.phpp...
1          0.02%  www‏.تحميل فيديو سكسcom
1          0.02%  wwxbbw
1          0.02%  wwسكس.com/eg-ar
1          0.02%  x video dr 69 @com net
1          0.02%  x videosسكس بنات واحصين
1          0.02%  xhamster's free mobile porn videos .uhtm
1          0.02%  xhmster .con
1          0.02%  xia cao yuan wei wenwen deng yan yang weiyan su yawei wei jiangnan yu and ximing xu * . incorporating ptgf-β1/calcium phosphat
1          0.02%  xing leontech
1          0.02%  xls 86@yahoo.com manufacturing chemical raw materials companies directory
1          0.02%  xls : email amirmuhammad 97 @yahoo.ae@hotmail.ae@gmail.ae (u.a.e) dubai
1          0.02%  xls @hotmail.se @yahoo.se @mail.se 2013
1          0.02%  xls @yahoo.ca@sympatico.ca@aol.com 2013
1          0.02%  xls automotive services gas stations auto rest areas supermarkets @yahoo com @hotmail com
1          0.02%  xls dealers of electronice list @ hotmail.com in taiwan
1          0.02%  xls email contacts all importers and dearlers aluminum product congo'@yahoo'
1          0.02%  xls email contacts all importers and exporters mable and tiles ghana'@yahoo'
1          0.02%  xls email contacts all importers and exporters marble and tiles togo'@yahoo'
1          0.02%  xls finetype personnels manager @aol.com@comcast.net@bellsouth.net@sbcglobal.net
1          0.02%  xls furniture companies @yahoo @gmail @hotmail
1          0.02%  xls john smith yahoo.com.jp 2013
1          0.02%  xls laptop companies @yahoo @gmail @hotmail
1          0.02%  xls managers@yahoo @gmail @hotmail
1          0.02%  xls mining companies @yahoo @gmail @hotmail
1          0.02%  xls oil companies in brazil @yahoo.com @gmail.com @hotmail.com @aol.com
1          0.02%  xls petrochemicals @yahoo com @hotmail com @aol com xls
1          0.02%  xls:csv. 966 email addressahmed@hotmail.fr@yahoo.fr@gmail.fr
1          0.02%  xmt toys alibaba comcom ly webhp
1          0.02%  xnnx.com .uae
1          0.02%  xnx .con .‎كلاب
1          0.02%  xnxx .cmo savadro de 2013
1          0.02%  xnxx .méxico
1          0.02%  xnxx @com
1          0.02%  xnxx free saxi 12sal school girl vedeo
1          0.02%  xnxx gy تايلندي
1          0.02%  xnxx vedeos malashi
1          0.02%  xnxx vidio mobill bbo girl
1          0.02%  xnxx vidio mobill egybt free bbo
1          0.02%  xnxx.comالکویت
1          0.02%  xnxx.medicalchinese
1          0.02%  xnxxarpe saode
1          0.02%  xnxxcom .indonesia
1          0.02%  xnxxتحميل صور سكس رجال
1          0.02%  xnxxتحميل للموبايل سكسي عبدات
1          0.02%  xnxxتحميل نيك من ألطيز
1          0.02%  xnxxتنزيل فديو
1          0.02%  xsl@ransa.co.cr @comcast.net @yahoo.com.sa
1          0.02%  xvibeosحصان نسو
1          0.02%  xvideo faemil sex com
1          0.02%  xvideos com mobile sexs msree
1          0.02%  xvideos(auandy)free
1          0.02%  xvidios indonesia sexs virgin vs bigtoot free
1          0.02%  xxlxسكس الحيوانات
1          0.02%  xxlxسكس نيك
1          0.02%  xxnx an san savador .cmo
1          0.02%  xxnxx trky 11
1          0.02%  xxvideo combodia asianwomen mai park
1          0.02%  xxx boy unblicks movies
1          0.02%  xxx mamandwoman.www.com
1          0.02%  xxx maturecom es 123456
1          0.02%  xxx sexy hot vidwos porn hub fucking oileng
1          0.02%  xxx thailaind vederos
1          0.02%  xxx video www.com yaho@
1          0.02%  xxx viedo sany laon
1          0.02%  xxx vip libeya
1          0.02%  xxx vip vederos
1          0.02%  xxx wwdatcam
1          0.02%  xxx.dog.girl.saxyes.co
1          0.02%  xxx.wed .web. lola .b f
1          0.02%  xxxbbw eanamal fuk
1          0.02%  xxxxvideo.pegnta
1          0.02%  xxxxxxxxxxxxxxxxy pictures of girl @hot male
1          0.02%  xxنيك مع الحيوانات
1          0.02%  xفلم
1          0.02%  yaho@ com
1          0.02%  yahoo aol comcast juno earthlink sbcglobal cox freenet 2014 fax ahmed
1          0.02%  yahoo email filetye:txt
1          0.02%  yahoo gmail@
1          0.02%  yahoo maiسكس موقعl بالعربي
1          0.02%  yahoo www com@
1          0.02%  yahoo مكتوبporn
1          0.02%  yahoo.cahotmail.cagmail.camail.ca.txt
1          0.02%  yahoo.com aol.com rr.com hotmail.com netzero.net excite.com bellsouth.net usa.com earthlink.net @ .txt or .txt
1          0.02%  yahoo.com t-online.de gmx.de karn 2013
1          0.02%  yahoo.com txt 2012
1          0.02%  yahooصورسكس
1          0.02%  yahya @ .om @yahoo.de @live.com
1          0.02%  yang@yahoo.com@hotmail.com @gmail.com@aol.com@123.com@126.com
1          0.02%  yasir@hotmail.com txt csv 2013
1          0.02%  yeah dog suppression_list csv
1          0.02%  yeahdog leads list 2013 nelson hotmail.com
1          0.02%  youporn %20 %20 brasileira.3gp
1          0.02%  youporn 12skm
1          0.02%  yuag@hotmail.com@aol.com@gmail.com@yahoo.co.jp txt 2013
1          0.02%  yusuf webmarste
1          0.02%  yusuf@hotmail.com 2013
1          0.02%  yusuf@yahoo.co.id@hotmail.com@gmail.comymail.com2012
1          0.02%  yáng @uol.com.br password
1          0.02%  z @vsnl.com or @cyber.net.pk or @omantel.net.om
1          0.02%  zak@yahoo.com@hotmail.com@gmail.com@aol.com 2011 txt
1          0.02%  zgh@hotmail.com aol.com gmail.com gmx.de txt
1          0.02%  zhang @gmail.com txt
1          0.02%  zhang@live.comgmail.com@aol.com@msn.com@yahoo.co.uk@att.nettxt2013
1          0.02%  zhang@yahoo.comymail.comhotmail.comaol.comgmail.comgmx.comfresh emails 26th 7 2013
1          0.02%  zheng @yahoo.co.th text
1          0.02%  zin@ 81@yahoo.jp@jobs@2013
1          0.02%  zinc oxide tape @netzero.net @twcny.rr.com @comcast.net @warwick.net @cs.com @verizon.net
1          0.02%  zinc plate @netvigator.com @yahoo.com @tradekey.com @alibaba.com
1          0.02%  zlhutviia@yahoo.com
1          0.02%  zofa society of emirates @yahoo.com @hotmail.com @gmail.com
1          0.02%  zulkifli-az1@yahoo.com
1          0.02%  zurıh nude sexkız
1          0.02%  zuzana@yahoo.com
1          0.02%  دانلودsexخشن رایگان
1          0.02%  çağrı @yahoo.com @gmail.com @hotmail.com@rediffmail.com
1          0.02%  электрический камин каминные
1          0.02%  أفلام سكس فرنسنية
1          0.02%  أفلام سكس موقع٩٨ حيوان
1          0.02%  اجمل موقع فبديوسكس تك
1          0.02%  اروع صورسكسsx
1          0.02%  اريدمشاهدةسكس.قوى.جدا
1          0.02%  اريدموقع تحميل مقاطع نياكه صغارمجان
1          0.02%  افلام sxsاوربى
1          0.02%  افلام زنوج سكس موحانا
1          0.02%  افلام سكس مصر عرب www.xx.oc.xm.nww.
1          0.02%  افلام مصرية جديدة سكس ww.oc.xx.mx2013
1          0.02%  افلام نيك سكس اروبى مجانى
1          0.02%  افلامس xxx18
1          0.02%  افلم سكس درمرك
1          0.02%  اقلم سكس
1          0.02%  اكبر موقع سكس حصنان وكلاب مع الفتيات منxxx
1          0.02%  الافلام سكسي جام2012
1          0.02%  الصورسكس عرب
1          0.02%  الصوسكس سا
1          0.02%  العاب كوردج الجبان سكسxxx
1          0.02%  بازی ورزش redwap 20013‏
1          0.02%  بحرسكس ملط
1          0.02%  بدي فيديوه سكس
1          0.02%  برامج nokia è66
1          0.02%  برامج رsex لاندرويد
1          0.02%  بنات سكس مصريxnxx mb3
1          0.02%  بنت سكس‎ ‎نيك طيذ
1          0.02%  بو رنوسكس نساء وحيوانات
1          0.02%  بورنو سكس النياكا عربي
1          0.02%  بورنو مشاهده مقاطع اكشن تيلاندي
1          0.02%  تحميل العاب فلاش سكسي من افضل المواقع hexat
1          0.02%  تحميل فيديو سكس رومانسي منxnxx‏ علي موبيل
1          0.02%  تحميل مقاطع منxnxx
1          0.02%  تحميل موقع 2013web tarek
1          0.02%  تحميل ‏gogle opra‏ مجانى موبيل
1          0.02%  تحميل ‏xnxx ‎‏
1          0.02%  تحميلwww.keto.sex.com
1          0.02%  تحمیل suzy wung
1          0.02%  تحمیل افلام جنس کلی بروک
1          0.02%  جوجل فديو سكس بنات وخيونات
1          0.02%  جيانامشيل mp4
1          0.02%  دانلود عكس سكسی انجرلا جولی
1          0.02%  دانلودsex arab girl
1          0.02%  دانلودsex emarat sarab
1          0.02%  دانلودsex video of cristal clear
1          0.02%  دانلودsex‏ ‏red wap‏ با حیوانات
1          0.02%  زبرواكس
1          0.02%  سارة جاي ‏xnxxللتحميل للموبايل
1          0.02%  ساكس عبي1
1          0.02%  سایتهای سکسیtube
1          0.02%  سقس نيك سمنيت
1          0.02%  سك نانسي redwap
1          0.02%  سكس اسرايل2
1          0.02%  سكس بنات برازيلز شيميل
1          0.02%  سكس حصان فريxvideos.com
1          0.02%  سكس حيوانات مع بشرxtgem
1          0.02%  سكس حيونات مع جناس
1          0.02%  سكس صور‎ ‎اجنبي٨٩
1          0.02%  سكس فيديو اوربى جديد 20013
1          0.02%  سكس لبنانى @x
1          0.02%  سكس لبنني
1          0.02%  سكس مصريxnxx veduo 3gp
1          0.02%  سكس موحرمت
1          0.02%  سكس نساء شرسات نار مجاني
1          0.02%  سكس نساه مع حيوانات حرسكس
1          0.02%  سكس نيك صيني نارأح
1          0.02%  سكس@في@الدرمارك
1          0.02%  سكس_شيميلات
1          0.02%  سكساجنب
1          0.02%  سكسكسكسكس
1          0.02%  سكسكسكسكسكسك تحميل م
1          0.02%  سكسى جينى 20013
1          0.02%  سکسfiletype:pdf
1          0.02%  سکسsite:www.google.com
1          0.02%  سکساوی
1          0.02%  سکسی .sexi
1          0.02%  صوار اولاد صغار بینکو بعظ
1          0.02%  صور بحرسكس روسي
1          0.02%  صور بنات فورسكس مع كلب جيوان
1          0.02%  صور رsex hot
1          0.02%  صور سجى حماد ف برنامج سابلنت
1          0.02%  صور سكس تيلندي مثير نيك طيز
1          0.02%  صور سكسbtng=
1          0.02%  صور في صطنبول سكس ولحس
1          0.02%  صور18 gay
1          0.02%  صورsexxxx rosey
1          0.02%  صورsexxxxxxxxx
1          0.02%  صورww.xnxx.com
1          0.02%  صوراباحيه وسكسيه ل لندا هاملتون
1          0.02%  صورالسکس بنت
1          0.02%  صوربنات سكسيxx
1          0.02%  صوربنات هولندسكس
1          0.02%  صورةزبر
1          0.02%  صورةسكس ندي ألغاع
1          0.02%  صورسكس
1          0.02%  صورسكس 01000
1          0.02%  صورسكس الدرمرك
1          0.02%  صورسكس اولادsxsgay
1          0.02%  صورسكس بادينات صغار
1          0.02%  صورسكس بلاك موقع98
1          0.02%  صورسكس بنات برازيل2010
1          0.02%  صورسكس بنت اسيا 20013
1          0.02%  صورسكس درمرك
1          0.02%  صورسكس شيميل مع احصانه
1          0.02%  صورسكس مسكسك
1          0.02%  صورسكس من برازيل2012
1          0.02%  صورسكس منxnxx
1          0.02%  صورسكس نساءفرنسي
1          0.02%  صورسكسسس كسسس
1          0.02%  صورشميل سكس
1          0.02%  صورشيميل ايطاليات
1          0.02%  صورشيميل عريان
1          0.02%  صورشيميل واحصنه سكس
1          0.02%  صورفرنسي سكس
1          0.02%  صورفرنسي سكس نيك
1          0.02%  صورقضيب وكس فيس بوك
1          0.02%  صوركس فعلم سكس13
1          0.02%  صورنيك جنس خيوأل وبنات
1          0.02%  صورنیک عربسکس
1          0.02%  صورنیک‎ sexبنات‎ ‎اروپا
1          0.02%  طيز allintitle: قصص جنس
1          0.02%  طيز.comجميل
1          0.02%  عربى سكس لبنانى @x
1          0.02%  عرض صورنيك جيناميشيل
1          0.02%  عرن سكس
1          0.02%  عکس زنان ورزشکار 2012 لندنxxxx
1          0.02%  عکس سکسی انجرلا جولی
1          0.02%  فبديوسكس
1          0.02%  فبديوسكس روسي تنزيل
1          0.02%  فديوبرنو صوركس أروبا
1          0.02%  فديونيك ومس
1          0.02%  فرمولاسیون داروها در نانوذرات پلیمری pdf
1          0.02%  فريه برنوسكس
1          0.02%  فلام اكبوت xxسكس
1          0.02%  فلام سكس حيوانات فراو
1          0.02%  في السكسxxx
1          0.02%  فيدو2013 سكس
1          0.02%  فيديو هات ‏sexقضيب كبير
1          0.02%  فيديوسكس2
1          0.02%  فيديوشميل مصري
1          0.02%  فيديوفك بورن 18سنة
1          0.02%  فيس بوك دينا البارقي وsexxxxx
1          0.02%  فيلم هندي89
1          0.02%  فیلم ‏sexهندی ‏download
1          0.02%  قوقل سكس بنات صغارعرب
1          0.02%  كس اولادsxsgay
1          0.02%  كوكل.برنوسيكس.فلك
1          0.02%  لبنان@@ 2013 hotmail.com yahoo.com
1          0.02%  لبنانی صورالسکس
1          0.02%  مثعث افلام جنسس جميل
1          0.02%  مسلسل هندي سكسxxnxx
1          0.02%  مشاهد فديو زبرواكس وا طيز
1          0.02%  مشاهدةسكس ليبي فيديو
1          0.02%  مشهدةافلامسكس
1          0.02%  مصريxnxx
1          0.02%  مغاطع سكس نجريا
1          0.02%  مقاطع xnxxعربي مصر
1          0.02%  مقاطع فديونيك اوربي
1          0.02%  مقاطع فديونيك مجاني 3gp
1          0.02%  مقاطع فيديوسكس2‎.‎
1          0.02%  مقاطع نيك طيز وكس اوربي صيني امريكي ويب
1          0.02%  مقاطعsex ‎ليبيا
1          0.02%  مليزي سيكسي
1          0.02%  من كتر النيك نترط ميه
1          0.02%  موأقع نيك سكسxxنيك تنزيل
1          0.02%  مواقع إباحيهwww features
1          0.02%  مواقعvedeo six اوروبا
1          0.02%  موزيلاسكس صور
1          0.02%  موقع .سكس مني ذكي
1          0.02%  موقع مقاطع وصورشيميلات زنوج
1          0.02%  موقع18qt
1          0.02%  موقعwww.96سكس
1          0.02%  مينا مصرى 20013 سكس xxmx
1          0.02%  نري .سكس
1          0.02%  نيك xxنيك بنات مجانا free
1          0.02%  نيك طيز @hot mail.com
1          0.02%  نيك مصوره من شيميل
1          0.02%  نيك وضع دنماكي سكسي
1          0.02%  نيك ولحس طبعي فرنسي
1          0.02%  يوتيوب سكس الشميﻻت عربيات
1          0.02%  يوتيوبsks
1          0.02%  يونيوبسكس
1          0.02%  ‎صوركس أبيض وسمين
1          0.02%  小品 @yahoo.com.tw @gmail.cm


Generated by Webalizer Version 2.23